IL12A (NM_000882) Human 3' UTR Clone

CAT#: SC206305

3`UTR clone of interleukin 12A (natural killer cell stimulatory factor 1 cytotoxic lymphocyte maturation factor 1 p35) (IL12A) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: IL12A
• Synonyms: CLMF; IL-12A; NFSK; NKSF1; P35
• ACCN: NM_000882
• Insert Size: 477 bp
• Sequence Data:
  Insert Sequence

  >SC206305 3'UTR clone of NM_000882
  The sequence shown below is from the reference sequence of NM_000882. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GTGATGAGCTATCTGAATGCTTCCTAAAAAGCGAGGTCCCTCCAAACCGTTGTCATTTTTATAAAACTTT
  GAAATGAGGAAACTTTGATAGGATGTGGATTAAGAACTAGGGAGGGGGAAAGAAGGATGGGACTATTACA
  TCCACATGATACCTCTGATCAAGTATTTTTGACATTTACTGTGGATAAATTGTTTTTAAGTTTTCATGAA
  TGAATTGCTAAGAAGGGAAAATATCCATCCTGAAGGTGTTTTTCATTCACTTTAATAGAAGGGCAAATAT
  TTATAAGCTATTTCTGTACCAAAGTGTTTGTGGAAACAAACATGTAAGCATAACTTATTTTAAAATATTT
  ATTTATATAACTTGGTAATCATGAAAGCATCTGAGCTAACTTATATTTATTTATGTTATATTTATTAAAT
  TATTTATCAAGTGTATTTGAAAAATATTTTTAAGTGTTCTAAAAATAAAAGTATTGA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_000882.2
• Summary: 'This gene encodes a subunit of a cytokine that acts on T and natural killer cells, and has a broad array of biological activities. The cytokine is a disulfide-linked heterodimer composed of the 35-kD subunit encoded by this gene, and a 40-kD subunit that is a member of the cytokine receptor family. This cytokine is required for the T-cell-independent induction of interferon (IFN)-gamma, and is important for the differentiation of both Th1 and Th2 cells. The responses of lymphocytes to this cytokine are mediated by the activator of transcription protein STAT4. Nitric oxide synthase 2A (NOS2A/NOS2) is found to be required for the signaling process of this cytokine in innate immunity. [provided by RefSeq, Jul 2008]'
• Locus ID: 3592