BNIP1 (NM_013980) Human 3' UTR Clone

CAT#: SC206326

3`UTR clone of BCL2/adenovirus E1B 19kDa interacting protein 1 (BNIP1) transcript variant BNIP1-c for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: BNIP1
• Synonyms: NIP1; SEC20; TRG-8
• ACCN: NM_013980
• Insert Size: 483 bp
• Sequence Data:
  Insert Sequence

  >SC206326 3'UTR clone of NM_013980
  The sequence shown below is from the reference sequence of NM_013980. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  AGCGGCTCTTTCCATTTTTGTGAGATCCCAAAGGTGCCAGTTCTGGCCCTTTCAGCTCCTGTTTCAGGAT
  CTGTCCTGGTTCCTGAGCTCTAGGCTGCTAAGCTGAGCCACACACCCCTCCGTTTGCACCAGTTGCCTGC
  AGGTTGGATGGAACACAGTGCCCCACTTTTCTGCAAGTAGCTGGCTTGTAAAGGGTGAACAGAGCCATGG
  GAGGAAGGTCTGGCATTGGGATGCCGCCCTGGGGACATACGAACCGCCTCCTTCCACCATTGTGCACTAT
  GGGAGGCCGCTGCTGCGTGGAGCACTTAAAGTCCAGCCTCCAGGACCGGATGCCCCTCCTGTCTCCCGCT
  CCCATCGTGCCCTTAAATGCCAGATCTGGTGGAGGGAAGAGAGAAGAGGTAGGAAGAAAGGTGATGAAAA
  CTCCTGGTCATTCCTTGAATAAACTTGATTTTATTTAATAGAATAAAATGTATTTGATTTTGT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_013980.2
• Summary: 'This gene is a member of the BCL2/adenovirus E1B 19 kd-interacting protein (BNIP) family. It interacts with the E1B 19 kDa protein, which protects cells from virally-induced cell death. The encoded protein also interacts with E1B 19 kDa-like sequences of BCL2, another apoptotic protector. In addition, this protein is involved in vesicle transport into the endoplasmic reticulum. Alternative splicing of this gene results in four protein products with identical N- and C-termini. [provided by RefSeq, Mar 2011]'
• Locus ID: 662