ENPP3 (NM_005021) Human 3' UTR Clone

CAT#: SC206355

3`UTR clone of ectonucleotide pyrophosphatase/phosphodiesterase 3 (ENPP3) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: ENPP3
• Synonyms: B10; CD203c; NPP3; PD-IBETA; PDNP3
• ACCN: NM_005021
• Insert Size: 463 bp
• Sequence Data:
  Insert Sequence

  >SC206355 3'UTR clone of NM_005021
  The sequence shown below is from the reference sequence of NM_005021. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TTTACCAACATTTGAAACCACTATTTAACTTAATAATGTCTACTTAATATATAATTTACTGTATAAAGTA
  ATTTTGGCAAAATATAAGTGATTTTTTTCTGGAGAATTGTAAAATAAAGTTTTCTATTTTTCCTTAAGTC
  CCCTAAAAGCCATAATTTTTATTATTCCTTTTTCTCTTTTTTCAATTCTATGAATATGTATTATTTTAAA
  GTTATATTTTTCACACAGAGATGATGCTATATTACACCTTCCCTTTTTTGTTGGTTTCTTAAACTCTAAT
  CTCATGACAGATTATACCTTCCTTATTACTTGTTTTATCTTACTCAGAATCTTTGAATATATTTTTCTGC
  CCAGAATTATCTAAACAAAAGGGAGAACAAAAGAAGTATGTCTCACTTGGGAACTGAATCAACTCTAAAT
  CAGTTTTGTCACAAAACTTTTTGTATTTGACTGGCAATGCTGA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_005021.3
• Summary: 'The protein encoded by this gene belongs to a series of ectoenzymes that are involved in hydrolysis of extracellular nucleotides. These ectoenzymes possess ATPase and ATP pyrophosphatase activities and are type II transmembrane proteins. Expression of the related rat mRNA has been found in a subset of immature glial cells and in the alimentary tract. The corresponding rat protein has been detected in the pancreas, small intestine, colon, and liver. The human mRNA is expressed in glioma cells, prostate, and uterus. Expression of the human protein has been detected in uterus, basophils, and mast cells. Two transcript variants, one protein coding and the other non-protein coding, have been found for this gene. [provided by RefSeq, Oct 2015]'
• Locus ID: 5169