POLD4 (NM_021173) Human 3' UTR Clone

CAT#: SC206423

3`UTR clone of polymerase (DNA-directed) delta 4 (POLD4) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: POLD4
• Synonyms: p12; POLDS
• ACCN: NM_021173
• Insert Size: 447
• Sequence Data:
  Insert Sequence

  >SC206423 3'UTR clone of NM_021173
  The sequence shown below is from the reference sequence of NM_021173. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  AGTGCAGTCTCTGGCATCTCTATCCCCTATGAGGCACCACGTAAGACCTCCTGCCCTTAGCTCTCTTGCT
  CACCACCCAAGAACCTCAGGACAGAAGCGAGAGCCCATTGCTCCTGCTCAGCTCAGCCCGGCTGCGGAGG
  AACCCTTGGCAGGCAGAACCTGGAGGTGTCAGAGGCTCAACTCCTCCATCTAACCAGCAGGCTCCCAGAG
  TCCCCGGAAGAGCCTGCGCAGCTGAAGCAGAGTGCTTCTAGATGGAGAGTGGTCACTGGGGAAAAGGACC
  TGGCCATCACCTTCCAATACCTGCTGCCTGTCTCCCTGACCCATGATCTGGCAAGTTAGGCACAGTCAGA
  CATGGACAGTTGATCCATGAGGAAAAGATGCTCTCCCACCTAAGGCCAGGAATCTGAGAGCAGGACTGGC
  TGAGCTCCCAGGGCAAGGGGTTCACTA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_021173.3
• Summary: This gene encodes the smallest subunit of DNA polymerase delta. DNA polymerase delta possesses both polymerase and 3' to 5' exonuclease activity and plays a critical role in DNA replication and repair. The encoded protein enhances the activity of DNA polymerase delta and plays a role in fork repair and stabilization through interactions with the DNA helicase Bloom syndrome protein. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Mar 2012]
• Locus ID: 57804