Leptin Receptor (LEPR) (NM_002303) Human 3' UTR Clone

CAT#: SC206473

3`UTR clone of leptin receptor (LEPR) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: LEPR
• Synonyms: CD295; LEP-R; LEPRD; OB-R; OBR
• ACCN: NM_002303
• Insert Size: 484 bp
• Sequence Data:
  Insert Sequence

  >SC206473 3'UTR clone of NM_002303
  The sequence shown below is from the reference sequence of NM_002303. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GGAAAACAAGATGTGTGACCTAACTGTGTAATTTCACTGAAGAAACCTTCAGATTTGTGTTATAATGGGT
  AATATAAAGTGTAATAGATTATAGTTGTGGGTGGGAGAGAGAAAAGAAACCAGAGTCAAATTTGAAAATA
  ATTGTTCCAAATGAATGTTGTCTGTTTGTTCTCTCTTAGTAACATAGACAAAAAATTTGAGAAAGCCTTC
  ATAAGCCTACCAATGTAGACACGCTCTTCTATTTTATTCCCAAGCTCTAGTGGGAAGGTCCCTTGTTTCC
  AGCTAGAAATAAGCCCAACAGACACCATCTTTTGTGAGATGTAATTGTTTTTTCAGAGGGCGTGTTGTTT
  TACCTCAAGTTTTTGTTTTGTACCAACACACACACACACACACATTCTTAACACATGTCCTTGTGTGTTT
  TGAGAGTATATTATGTATTTATATTTTGTGCTATCAGACTGTAGGATTTGAAGTAGGACTTTCC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_002303.4
• Summary: 'The protein encoded by this gene belongs to the gp130 family of cytokine receptors that are known to stimulate gene transcription via activation of cytosolic STAT proteins. This protein is a receptor for leptin (an adipocyte-specific hormone that regulates body weight), and is involved in the regulation of fat metabolism, as well as in a novel hematopoietic pathway that is required for normal lymphopoiesis. Mutations in this gene have been associated with obesity and pituitary dysfunction. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. It is noteworthy that this gene and LEPROT gene (GeneID:54741) share the same promoter and the first 2 exons, however, encode distinct proteins (PMID:9207021).[provided by RefSeq, Nov 2010]'
• Locus ID: 3953