CLCA4 (NM_012128) Human 3' UTR Clone

CAT#: SC206504

3`UTR clone of chloride channel accessory 4 (CLCA4) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CLCA4
• Synonyms: CaCC; CaCC2
• ACCN: NM_012128
• Insert Size: 406
• Sequence Data:
  Insert Sequence

  >SC206504 3'UTR clone of NM_012128
  The sequence shown below is from the reference sequence of NM_012128. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  ATTTTAAGTACCACCATTTGAACCTTAACGAAGAAAAAAATCTTCAAGTAGACCTAGAAGAGAGTTTTAA
  AAAACAAAACAATGTAAGTAAAGGATATTTCTGAATCTTAAAATTCATCCCATGTGTGATCATAAACTCA
  TAAAAATAATTTTAAGATGTCGGAAAAGGATACTTTGATTAAATAAAAACACTCATGGATATGTAAAAAC
  TGTCAAGATTAAAATTTAATAGTTTCATTTATTTGTTATTTTATTTGTAAGAAATAGTGATGAACAAAGA
  TCCTTTTTCATACTGATACCTGGTTGTATATTATTTGATGCAACAGTTTTCTGAAATGATATTTCAAATT
  GCATCAAGAAATTAAAATCATCTATCTGAGTAGTCAAAATACAAGTAAAGGAGAGC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_012128.3
• Summary: The protein encoded by this gene belongs to the calcium sensitive chloride conductance protein family. To date, all members of this gene family map to the same site on chromosome 1p31-p22 and share high degrees of homology in size, sequence and predicted structure, but differ significantly in their tissue distributions. Alternative splicing results in multiple transcript variants, only one of which is thought to be protein coding. [provided by RefSeq, Dec 2008]
• Locus ID: 22802