Secretogranin V (SCG5) (NM_003020) Human 3' UTR Clone

CAT#: SC206593

3`UTR clone of secretogranin V (7B2 protein) (SCG5) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: SCG5
• Synonyms: 7B2; P7B2; SGNE1; SgV
• ACCN: NM_003020
• Insert Size: 494 bp
• Sequence Data:
  Insert Sequence

  >SC206593 3'UTR clone of NM_003020
  The sequence shown below is from the reference sequence of NM_003020. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CCATTTTTCAGATGAGGATAAGGATCCAGAGTAAAGAGAAGATGCTAGACGAAAACCCACATTACCTGTT
  AGGCCTCAGCATGGCTTATGTGCACGTGTAAATGGAGTCCCTGTGAATGACAGCATGTTTCTTACATAGA
  TAATTATGGATACAAAGCAGCTGTATGTAGATAGTGTATTGTCTTCACACCGATGATTCTGCTTTTTGCT
  AAATTAGAATAAGAGCTTTTTTGTTTCTTGGGTTTTTAAAATGTGAATCTGCAATGATCATAAAAATTAA
  AATGTGAATGTCAACAATAAAAAGCAAGACTATGAAAGGCTCAGATTTCTTGCAGTTTAAAATGGTGTCT
  GAGGTTGTACTATTTTGGCCAAGTCTGTAGAAAGCTGTCATTTGATTTTGATTATGTAGTTCATCCAGCC
  CTTGGGCATTGTTATACACCAGTAAAGAAGGCTGTACTCAAGAGGAGGAGCTGACACATTTCACTTGGCT
  GCGT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_003020.3
• Summary: 'This gene encodes a secreted chaperone protein that prevents the aggregation of other secreted proteins, including proteins that are associated with neurodegenerative and metabolic disease. The encoded protein may be best known for its role in the trafficking and activation of prohormone convertase PC2 (encoded by Gene ID: 5126). Phosphorylation of the encoded protein has been shown to have an inhibitory effect on its chaperone function. This gene also produces a ARHGAP11A-SCG5 readthrough transcript and ARHGAP11A-SCG5 protein. [provided by RefSeq, Feb 2019]'
• Locus ID: 6447