Glutathione S Transferase alpha 1 (GSTA1) (NM_145740) Human 3' UTR Clone

CAT#: SC206665

3`UTR clone of glutathione S-transferase alpha 1 (GSTA1) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: GSTA1
• Synonyms: GST-epsilon; GST2; GSTA1-1; GTH1
• ACCN: NM_145740
• Insert Size: 476 bp
• Sequence Data:
  Insert Sequence

  >SC206665 3'UTR clone of NM_145740
  The sequence shown below is from the reference sequence of NM_145740. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GAAGCAAGGAAGATTTTCAGGTTTTAATAACGCAGTCATGGAGGCCAAGAACTTGCAATACCAATGTTCT
  AAAGTTTTGCAACAATAAAGTACTTTACCTAAGTGTTGATTGTGCCTGTTGTGAAGCTAATGAACTCTTT
  CAAATTATATGCTAATTAAATAATACAACTCCTATTCGCTGACTTAGTTAAAATTGATTTGTTTTCATTA
  GGATCTGATGTGAATTCAGATTTCCAATCTTCTCCTAGCCAACCATTTTCCTGGAATTAAAAATTCAGTA
  AAAAAGGAAACTATAGATTATGTGGTTTGTTTGACTTTTCCAAGAATTGTCCCGTAACATACAATTTGTC
  ATACAATCTATTAAAATGTCAATGTAGAAATGCACTTCTGACATTTTCAGGTATGCACAGGAGAAGAGTT
  ACCATCCTGGATAATGGCATAAAGACATTTTCTTCTTTTCCTGGACAGTCATTTTA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_145740.3
• Summary: 'This gene encodes a member of a family of enzymes that function to add glutathione to target electrophilic compounds, including carcinogens, therapeutic drugs, environmental toxins, and products of oxidative stress. This action is an important step in detoxification of these compounds. This subfamily of enzymes has a particular role in protecting cells from reactive oxygen species and the products of peroxidation. Polymorphisms in this gene influence the ability of individuals to metabolize different drugs. This gene is located in a cluster of similar genes and pseudogenes on chromosome 6. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]'
• Locus ID: 2938