CXCR3 (NM_001504) Human 3' UTR Clone

CAT#: SC206666

3`UTR clone of chemokine (C-X-C motif) receptor 3 (CXCR3) transcript variant A for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CXCR3
• Synonyms: CD182; CD183; CKR-L2; CMKAR3; GPR9; IP10-R; Mig-R; MigR
• ACCN: NM_001504
• Insert Size: 492 bp
• Sequence Data:
  Insert Sequence

  >SC206666 3'UTR clone of NM_001504
  The sequence shown below is from the reference sequence of NM_001504. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TTCATCCTGGTCTGAGACCTCAGAGGCCTCCTACTCGGGCTTGTGAGGCCGGAATCCGGGCTCCCCTTTC
  GCCCACAGTCTGACTTCCCCGCATTCCAGGCTCCTCCCTCCCTCTGCCGGCTCTGGCTCTCCCCAATATC
  CTCGCTCCCGGGACTCACTGGCAGCCCCAGCACCACCAGGTCTCCCGGGAAGCCACCCTCCCAGCTCTGA
  GGACTGCACCATTGCTGCTCCTTAGCTGCCAAGCCCCATCCTGCCGCCCGAGGTGGCTGCCTGGAGCCCC
  ACTGCCCTTCTCATTTGGAAACTAAAACTTCATCTTCCCCAAGTGCGGGGAGTACAAGGCATGGCGTAGA
  GGGTGCTGCCCCATGAAGCCACAGCCCAGGCCTCCAGCTCAGCAGTGACTGTGGCCATGGTCCCCAAGAC
  CTCTATATTTGCTCTTTTATTTTTATGTCTAAAATCCTGCTTAAAACTTTTCAATAAACAAGATCGTCAG
  GA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001504.1
• Summary: 'This gene encodes a G protein-coupled receptor with selectivity for three chemokines, termed CXCL9/Mig (monokine induced by interferon-g), CXCL10/IP10 (interferon-g-inducible 10 kDa protein) and CXCL11/I-TAC (interferon-inducible T cell a-chemoattractant). Binding of chemokines to this protein induces cellular responses that are involved in leukocyte traffic, most notably integrin activation, cytoskeletal changes and chemotactic migration. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. One of the isoforms (CXCR3-B) shows high affinity binding to chemokine, CXCL4/PF4 (PMID:12782716). [provided by RefSeq, Jun 2011]'
• Locus ID: 2833