DMGDH (NM_013391) Human 3' UTR Clone

CAT#: SC206697

3`UTR clone of dimethylglycine dehydrogenase (DMGDH) nuclear gene encoding mitochondrial protein for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: DMGDH
• Synonyms: DMGDHD; ME2GLYDH
• ACCN: NM_013391
• Insert Size: 478
• Sequence Data:
  Insert Sequence

  >SC206697 3'UTR clone of NM_013391
  The sequence shown below is from the reference sequence of NM_013391. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  AGGTGGAAAGGACAAAACTTGAAAAAAGACCTTCAGCAGTCAACTGAATTAGAGTTGCTAATGACTGTCC
  TTGAAATTATTATAACTGGCTCCCAGGGGAATAGAGGAAACCAGGAATTCATTTCAAAATCATCAAAGTC
  TAAATTTAGAATCTTAATGAAACCTTTCTGTTAAGTGTTTTCTAAGCAAGACAGAATAATAGATAAATGA
  TTTACATTGTTCTTTTAAATGAAGAAATTTGAAATGAATGTTTTTTTATTTACCCCACATTACCCAATCA
  GTAAAACATTTAGGTGTTTGCTAATATACACAATCATTACTATAACCTAATTAAGGGACATTTTATAATT
  TTAGTAACAAATGCATTCGGTTCTTGACAGCTGAAAACAAATTAATAAATTATCTTTTACATAAAAACAT
  GTACAATATTGTTTATGGATTTACTTCTTTGAGAAATCTTTCCTTAGATGAATAAATG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_013391.2
• Summary: This gene encodes an enzyme involved in the catabolism of choline, catalyzing the oxidative demethylation of dimethylglycine to form sarcosine. The enzyme is found as a monomer in the mitochondrial matrix, and uses flavin adenine dinucleotide and folate as cofactors. Mutation in this gene causes dimethylglycine dehydrogenase deficiency, characterized by a fishlike body odor, chronic muscle fatigue, and elevated levels of the muscle form of creatine kinase in serum. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
• Locus ID: 29958