cIAP1 (BIRC2) (NM_001166) Human 3' UTR Clone

CAT#: SC206702

3`UTR clone of baculoviral IAP repeat-containing 2 (BIRC2) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: BIRC2
• Synonyms: API1; c-IAP1; cIAP1; Hiap-2; HIAP2; MIHB; RNF48
• ACCN: NM_001166
• Insert Size: 504 bp
• Sequence Data:
  Insert Sequence

  >SC206702 3'UTR clone of NM_001166
  The sequence shown below is from the reference sequence of NM_001166. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GGTACTGTTCGTACATTTCTCTCTTAAAGAAAAATAGTCTATATTTTAACCTGCATAAAAAGGTCTTTAA
  AATATTGTTGAACACTTGAAGCCATCTAAAGTAAAAAGGGAATTATGAGTTTTTCAATTAGTAACATTCA
  TGTTCTAGTCTGCTTTGGTACTAATAATCTTGTTTCTGAAAAGATGGTATCATATATTTAATCTTAATCT
  GTTTATTTACAAGGGAAGATTTATGTTTGGTGAACTATATTAGTATGTATGTGTACCTAAGGGAGTAGTG
  TCACTGCTTGTTATGCATCATTTCAGGAGTTACTGGATTTGTTGTTCTTTCAGAAAGCTTTGAATACTAA
  ATTATAGTGTAGAAAAGAACTGGAAACCAGGAACTCTGGAGTTCATCAGAGTTATGGTGCCGAATTGTCT
  TTGGTGCTTTTCACTTGTGTTTTAAAATAAGGATTTTTCTCTTATTTCTCCCCCTAGTTTGTGAGAAACA
  TCTCAATAAAGTGC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001166.3
• Summary: 'The protein encoded by this gene is a member of a family of proteins that inhibits apoptosis by binding to tumor necrosis factor receptor-associated factors TRAF1 and TRAF2, probably by interfering with activation of ICE-like proteases. This encoded protein inhibits apoptosis induced by serum deprivation and menadione, a potent inducer of free radicals. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]'
• Locus ID: 329