FYN (NM_153048) Human 3' UTR Clone

CAT#: SC206703

3`UTR clone of FYN oncogene related to SRC FGR YES (FYN) transcript variant 3 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol FYN
Synonyms p59-FYN; SLK; SYN
ACCN NM_153048
Insert Size 475 bp
Sequence Data
>SC206703 3'UTR clone of NM_153048
The sequence shown below is from the reference sequence of NM_153048. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

ACTTTACCGCGACAGAGCCCCAGTACCAACCTGGTGAAAACCTGTAAGGCCCGGGTCTGCGGAGAGAGGC
CTTGTCCCAGAGGCTGCCCCACCCCTCCCCATTAGCTTTCAATTCCGTAGCCAGCTGCTCCCCAGCAGCG
GAACCGCCCAGGATCAGATTGCATGTGACTCTGAAGCTGACGAACTTCCATGGCCCTCATTAATGACACT
TGTCCCCAAATCCGAACCTCCTCTGTGAAGCATTCGAGACAGAACCTTGTTATTTCTCAGACTTTGGAAA
ATGCATTGTATCGATGTTATGTAAAAGGCCAAACCTCTGTTCAGTGTAAATAGTTACTCCAGTGCCAACA
ATCCTAGTGCTTTCCTTTTTTAAAAATGCAAATCCTATGTGATTTTAACTCTGTCTTCACCTGATTCAAC
TAAAAAAAAAAAAGTATTATTTTCCAAAAGTGGCCTCTTTGTCTAAAACAATAAA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_153048.1
Summary 'This gene is a member of the protein-tyrosine kinase oncogene family. It encodes a membrane-associated tyrosine kinase that has been implicated in the control of cell growth. The protein associates with the p85 subunit of phosphatidylinositol 3-kinase and interacts with the fyn-binding protein. Alternatively spliced transcript variants encoding distinct isoforms exist. [provided by RefSeq, Jul 2008]'
Locus ID 2534

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.