GSTA2 (NM_000846) Human 3' UTR Clone

CAT#: SC206753

3`UTR clone of glutathione S-transferase alpha 2 (GSTA2) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: GSTA2
• Synonyms: GST2; GSTA2-2; GTA2; GTH2
• ACCN: NM_000846
• Insert Size: 503 bp
• Sequence Data:
  Insert Sequence

  >SC206753 3'UTR clone of NM_000846
  The sequence shown below is from the reference sequence of NM_000846. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GAATCAAGGAAGATTTTCAGGTTTTAATAAACCAGCCATAGAGGTCAAGAACATGCAAGACCAGTATTCT
  AAAGTTTTGCAACAATTAAGTGCTTTACCTAAGTGTTGATTGTGCCTGTTGTGAAGCTAATGAACTCTTT
  CAAATTATATGCTAATTAAATAATACAACTCCTATTCACCCACTTAGTTAAAATTGATTTCTTCTCATTA
  GGATCTGATGTGAATTCAGTTTTCCAATCTCCTCCTAGCCAACAATTTTCTTGGAATTACAAATTCAGTA
  AAAATGGAAACTATAAATTATGTGGTTTGTTTGACTTTTCCAAGAATTGCCCTGTAACATACAATTTGTC
  ATACAATCTATTAAAATGCCAATGTAAAAATGCACCTCTGACATTTTCAGGTATGCACAGGAGAAGAGTT
  ACCATCCTGGATAATGGCATAAAGACATTTTCTTCTTTTCCTGAACAGTCATTTTATTTCTGATAAAAGC
  ATTCTTTCTAATG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_000846.4
• Summary: 'Cytosolic and membrane-bound forms of glutathione S-transferase are encoded by two distinct supergene families. These enzymes function in the detoxification of electrophilic compounds, including carcinogens, therapeutic drugs, environmental toxins and products of oxidative stress, by conjugation with glutathione. The genes encoding these enzymes are known to be highly polymorphic. These genetic variations can change an individual's susceptibility to carcinogens and toxins as well as affect the toxicity and efficacy of some drugs. At present, eight distinct classes of the soluble cytoplasmic mammalian glutathione S-transferases have been identified: alpha, kappa, mu, omega, pi, sigma, theta and zeta. This gene encodes a glutathione S-tranferase belonging to the alpha class. The alpha class genes, located in a cluster mapped to chromosome 6, are the most abundantly expressed glutathione S-transferases in liver. In addition to metabolizing bilirubin and certain anti-cancer drugs in the liver, the alpha class of these enzymes exhibit glutathione peroxidase activity thereby protecting the cells from reactive oxygen species and the products of peroxidation. [provided by RefSeq, Jul 2008]'
• Locus ID: 2939