ATP6V0C (NM_001694) Human 3' UTR Clone

CAT#: SC206825

3`UTR clone of ATPase H+ transporting lysosomal 16kDa V0 subunit c (ATP6V0C) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: ATP6V0C
• Synonyms: ATP6C; ATP6L; ATPL; VATL; Vma3; VPPC
• ACCN: NM_001694
• Insert Size: 500 bp
• Sequence Data:
  Insert Sequence

  >SC206825 3'UTR clone of NM_001694
  The sequence shown below is from the reference sequence of NM_001694. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CCTCTACGGTCTCATCGTCGCCCTCATCCTCTCCACAAAGTAGACCCTCTCCGAGCCCACCAGCCACAGA
  ATATTATGTAAAGACCACCCCTCCTCATTCCAGAACGAACAGCCTGACACATACGCACGGGGCCGCCGCC
  CCCAGTAGTTGGTCTTGTACATGCGCAGTGTCCTAGTGCCCATCGTCTGTTTCCCCGGCCTTGCCCCCGC
  CCGCCCCGTGCCGTGGACATCTGGGCCCACTCATCGCCCCTCCAGGCCCCCGGCGCCCCACCCCCTAGAG
  TGCTCTGTGTATGCGGATGATTTAGAATTGTCATTTCTCTTTACTGGATGTTTATTTATAAAGATCTGGC
  CTGTTCCTGCGTCTGCGGAGCGGCCCTTGTCTCCCAGCTATCTATAACCTTAGCTAGAGTGTCGCCTTGT
  GGGTTCCTGTTGCTGAGACTTCCTGGATGGAGCCGCCCTCACCGCCGGGCCCGTGGCCCTGCGCGGAGCT
  GTGTCCAATA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001694.2
• Summary: 'This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of eukaryotic intracellular organelles. V-ATPase dependent organelle acidification is necessary for such intracellular processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. V-ATPase is composed of a cytosolic V1 domain and a transmembrane V0 domain. The V1 domain consists of three A and three B subunits, two G subunits plus the C, D, E, F, and H subunits. The V1 domain contains the ATP catalytic site. The V0 domain consists of five different subunits: a, c, c', c", and d. This gene encodes the V0 subunit c. Alternative splicing results in transcript variants. Pseudogenes have been identified on chromosomes 6 and 17. [provided by RefSeq, Nov 2010]'
• Locus ID: 527