VEGFB (NM_003377) Human 3' UTR Clone

CAT#: SC206847

3`UTR clone of vascular endothelial growth factor B (VEGFB) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: VEGFB
• Synonyms: VEGFL; VRF
• ACCN: NM_003377
• Insert Size: 484 bp
• Sequence Data:
  Insert Sequence

  >SC206847 3'UTR clone of NM_003377
  The sequence shown below is from the reference sequence of NM_003377. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  AGCTTCCTCCGTTGCCAAGGGCGGGGCTTAGAGCTCAACCCAGACACCTGCAGGTGCCGGAAGCTGCGAA
  GGTGACACATGGCTTTTCAGACTCAGCAGGGTGACTTGCCTCAGAGGCTATATCCCAGTGGGGGAACAAA
  GAGGAGCCTGGTAAAAAACAGCCAAGCCCCCAAGACCTCAGCCCAGGCAGAAGCTGCTCTAGGACCTGGG
  CCTCTCAGAGGGCTCTTCTGCCATCCCTTGTCTCCCTGAGGCCATCATCAAACAGGACAGAGTTGGAAGA
  GGAGACTGGGAGGCAGCAAGAGGGGTCACATACCAGCTCAGGGGAGAATGGAGTACTGTCTCAGTTTCTA
  ACCACTCTGTGCAAGTAAGCATCTTACAACTGGCTCTTCCTCCCCTCACTAAGAAGACCCAAACCTCTGC
  ATAATGGGATTTGGGCTTTGGTACAAGAACTGTGACCCCCAACCCTGATAAAAGAGATGGAAGG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_003377.3
• Summary: 'This gene encodes a member of the PDGF (platelet-derived growth factor)/VEGF (vascular endothelial growth factor) family. The VEGF family members regulate the formation of blood vessels and are involved in endothelial cell physiology. This member is a ligand for VEGFR-1 (vascular endothelial growth factor receptor 1) and NRP-1 (neuropilin-1). Studies in mice showed that this gene was co-expressed with nuclear-encoded mitochondrial genes and the encoded protein specifically controlled endothelial uptake of fatty acids. Alternatively spliced transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Sep 2011]'
• Locus ID: 7423