PTGES2 (NM_025072) Human 3' UTR Clone

CAT#: SC206855

3`UTR clone of prostaglandin E synthase 2 (PTGES2) transcript variant 1 for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "PTGES2"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol PTGES2
Synonyms C9orf15; GBF-1; GBF1; mPGES-2; PGES2
ACCN NM_025072
Insert Size 495
Sequence Data
>SC206855 3'UTR clone of NM_025072
The sequence shown below is from the reference sequence of NM_025072. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

ACCTGCGGGTGGAGAGGGCCATCACCGAGGCCTCCCCAGCGCACTGAATGTCCCCGCGCAGAGCAGAGGG
AAGGCAGCGGAAGACGCCAGCTGCCAGGGCCTGGGGCCACTGGGCCAGCGCCTGGCGATACTGGTTGGGG
GCAGGATCATTCTGCCCCTTGTCCACGCACCCCCACCAGCCCTCTCGCTTCTAACACAGGGCACCTGCTG
GGGCTCAGGGATGTTAGGGACGAGTTCCAGCCCTGCCACTGCCCTGGGGCGACCCCTCCCTGTCCCTGCC
TCCCTGCTCTGCCGCCCCTCTTCCTGGACCCTCAGTGGCTGTCCCATGGCTACATCCTGTGGGTGGGGGC
CCTCGACAGGACAGCAGGACGGTTTGTTTTCAGTGGAATCCCATCCCTGGGTTCCCCTGGTTCCCACTCT
TCCCAAGCCTCCCGGGACTGGGACATGTTTGCAATAAAGGAAAGGTTTGTGGCGCCTGTCATGGCAGGCA
TCTCA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_025072.5
Summary The protein encoded by this gene is a membrane-associated prostaglandin E synthase, which catalyzes the conversion of prostaglandin H2 to prostaglandin E2. This protein also has been shown to activate the transcription regulated by a gamma-interferon-activated transcription element (GATE). Multiple transcript variants have been found for this gene. [provided by RefSeq, Jun 2009]
Locus ID 80142

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.