CACNG6 (NM_145814) Human 3' UTR Clone

CAT#: SC206910

3`UTR clone of calcium channel voltage-dependent gamma subunit 6 (CACNG6) transcript variant 1 for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "CACNG6"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol CACNG6
Synonyms 2310033H20Rik; AW050150; calcium channel, voltage-dependent, gamma subunit 6; MGC144251; MGC144252; voltage-dependent calcium channel gamma-6 subunit
ACCN NM_145814
Insert Size 494
Sequence Data
>SC206910 3'UTR clone of NM_145814
The sequence shown below is from the reference sequence of NM_145814. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GGTCCCTCTGTCCCAAGCGGGGGCACCGGGCCACCTAGAGCCACGCGTGAGACTTCTCTAAGCAACCACC
GAGCCCTTTGACCTTCTCCATTGTACCCCCAAGATCTTTTTGCCCCATCTCCTAGAGAAACTGTGTTCTC
CCTGCTCGGGGGCCCATGTTTTTTTACACGCCTGCCTCCTGTCCCCTTATCCTTTCTCCCTCTGTAAATA
CGTTTTTCTCTGTGGCTGTATGTGGGTTGCTTGGGGGTGGGATGGGAAGAGGCTCTTTGCAAACGAGGGT
CCCCAGAGAAGACTGGCGGGGACCTGATGGGGTAGCTGGGGTGTGGGGTTGGGGGATGAGGTCAGGGGGT
CTTGGGTGGGAGTTGGGGGCCCCTTCATTTCCCAGGTCTGGATCGATTCACTTGCCGGGAGAGACTTTTT
ACAACTCATCTGCAGCTCCGGGTGCGGTTGGGGGAGATAGCGAAGGGTCTGGCCTCGCTGTGATCTGATT
TGGG

CGGACCGTTACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-RsrII     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_145814.1
Summary Voltage-dependent calcium channels are composed of five subunits. The protein encoded by this gene represents one of these subunits, gamma, and is one of two known gamma subunit proteins. This particular gamma subunit is an integral membrane protein that is thought to stabilize the calcium channel in an inactive (closed) state. This gene is part of a functionally diverse eight-member protein subfamily of the PMP-22/EMP/MP20 family and is located in a cluster with two family members that function as transmembrane AMPA receptor regulatory proteins (TARPs). Alternative splicing results in multiple transcript variants. Variants in this gene have been associated with aspirin-intolerant asthma. [provided by RefSeq, Dec 2010]
Locus ID 59285

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.