RUFY1 (NM_025158) Human 3' UTR Clone

CAT#: SC206970

3`UTR clone of RUN and FYVE domain containing 1 (RUFY1) transcript variant 1 for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "RUFY1"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol RUFY1
Synonyms RABIP4; ZFYVE12
ACCN NM_025158
Insert Size 516
Sequence Data
>SC206970 3'UTR clone of NM_025158
The sequence shown below is from the reference sequence of NM_025158. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

TGCCACACCCTGCTCCTGCAGCGCTGCTCCTCCACGGCCTCCTGAACGTCCGTCCTCAGGAGCACAGCCT
CACGGACAGTGCCAAACCCTGTGGGTCTCCAGGGGCTTGGGAAATGTGTTCTTTCCCAAGAGTATCAAAG
GAAAGAATCAAATTTCTTGCCCGGTCACTGGCACTCCAGAAGACAGCGTGCCGGAACCGGCAGCTCTCAC
CTTTCTGTGACTTGTTCGGAATTAACTCCTCTGGATGGAAACTTCCATCTTACTTGGTTACATCACGGCT
CTGGTTCAGATACAACTTCATGATTTTGCTACTATCATTTTTCACTTTTCAAAGAATTTAACCTATTTTA
CAGCAGTTCAGTTCTGCTAGTGAGTAGTTTTCCTCTCCTACCTTCCTTCTAAAAACCTGATTCATGCACA
GCGTTTGACACACATGGAGTCTGCCAGTGTGCCTTCTCTGCTTCAGACAAGAGATCTGCCATTTCATGCC
CTTGTGACTACCTATCATTGGCCCTG

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_025158.3
Summary This gene encodes a protein that contains a RUN domain and a FYVE-type zinc finger domain. The encoded protein binds to phosphatidylinositol-3-phosphate (PI3P) and plays a role in early endosomal trafficking, tethering and fusion through interactions with small GTPases including Rab4, Rab5 and Rab14. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
Locus ID 80230

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.