NKG2C (KLRC2) (NM_002260) Human 3' UTR Clone

CAT#: SC206986

3`UTR clone of killer cell lectin-like receptor subfamily C member 2 (KLRC2) for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "KLRC2"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol KLRC2
Synonyms CD159c; NKG2-C; NKG2C
ACCN NM_002260
Insert Size 552 bp
Sequence Data
>SC206986 3'UTR clone of NM_002260
The sequence shown below is from the reference sequence of NM_002260. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CCAGTGTGGATCTTCAATGATATATCATTGTAAGCATAAGCTTTAGAAGTAAAGCATTTGCGTTTGCAGT
GCATCAGATACATTTTATATTTCTTAAAATAGAAATATTATGATTGCATAAATCTGAAAATGAATTATGT
TATTTGCTCTGATACAAAAATTCTAAATCAATTATTGAAATAGGATGCACACAATTACTAAAGTACAGAC
ATCCTAGCATTTGTGTCGGGCTCATTTTGCTCAACATGGTATTTGTGGTTTTCAGCCTTTCTAAAAGTTG
CATGTTATGTGAGTCAGCTTATAGGAAGTACCAAGAACAGTCAAACCCATGGAGACAGAAAGTAGAATAG
TGGTTGCCAATGTCTCAGGGAGGTTGAAATAGGAGATGACCACTAATTGATAGAACGTTTCTTTGTGTCG
TGATGAAAACTTTCTAAATTTCAGTAGTGGTGATGGTTGTAACTCTGCGAATATACTAAACATCATTGAT
TTTTAATCATTTTAAGTGCATGAAATGTATGCTTTGTACATGACACTTCAATAAAGCTATCC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_002260.3
Summary 'Natural killer (NK) cells are lymphocytes that can mediate lysis of certain tumor cells and virus-infected cells without previous activation. They can also regulate specific humoral and cell-mediated immunity. NK cells preferentially express several calcium-dependent (C-type) lectins, which have been implicated in the regulation of NK cell function. The group, designated KLRC (NKG2) are expressed primarily in natural killer (NK) cells and encodes a family of transmembrane proteins characterized by a type II membrane orientation (extracellular C terminus) and the presence of a C-type lectin domain. The KLRC (NKG2) gene family is located within the NK complex, a region that contains several C-type lectin genes preferentially expressed on NK cells. KLRC2 alternative splice variants have been described but their full-length nature has not been determined. [provided by RefSeq, Jul 2008]'
Locus ID 3822

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.