SAPK3 (MAPK12) (NM_002969) Human 3' UTR Clone

CAT#: SC207027

3`UTR clone of mitogen-activated protein kinase 12 (MAPK12) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: MAPK12
• Synonyms: ERK-6; ERK3; ERK6; MAPK 12; P38GAMMA; PRKM12; SAPK-3; SAPK3
• ACCN: NM_002969
• Insert Size: 502 bp
• Sequence Data:
  Insert Sequence

  >SC207027 3'UTR clone of NM_002969
  The sequence shown below is from the reference sequence of NM_002969. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  AAGGAGACGCCTCTGTGAAGATCTCTGGGCTCCGGGGTGGCAGTGAGGACCACCTTCACCTTCCACCTGA
  GAGGGGACTCTCGTTGCCACCTTGACCTTGGCTGGGGCTTGCATCCCAAGGCATCCATCAGAGCAGACGC
  CCGGGTTCCATGGACCCTCCTCCCCACGGCCATGCCTCTGCTCTTGGGCGCCCATCATGGAGGAGCACCT
  GAACTTTCTGGACAAGACCTCTGGCCGACCTGGGGATGGCCTCTGATCCCTGGAGCAGTGGCCCACTTGC
  CCGGTGCTCTCAGAAACCTCAGAGCTGGTGGGGCTCCAGATCAGGCCTTGGCCTCTGAGCCCTGCCTGCT
  CTGGGCCATGCAGAGGAAGGACAGAGGGTGGGCGCAGGGCACCAACTCAGGGACATCCCCTCTCCTGGGC
  GACGTCAGTGGACCTTCCTGCACCCCCAGCCTGGAATGTAAATCAGCTGTGTGGTGCCCGCGTGGCTGGA
  AGGAAATAGACC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_002969.3
• Summary: 'Activation of members of the mitogen-activated protein kinase family is a major mechanism for transduction of extracellular signals. Stress-activated protein kinases are one subclass of MAP kinases. The protein encoded by this gene functions as a signal transducer during differentiation of myoblasts to myotubes. [provided by RefSeq, Jul 2008]'
• Locus ID: 6300