HS3ST3A1 (NM_006042) Human 3' UTR Clone

CAT#: SC207077

3`UTR clone of heparan sulfate (glucosamine) 3-O-sulfotransferase 3A1 (HS3ST3A1) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: HS3ST3A1
• Synonyms: 3-OST-3A; 3OST3A1
• ACCN: NM_006042
• Insert Size: 503
• Sequence Data:
  Insert Sequence

  >SC207077 3'UTR clone of NM_006042
  The sequence shown below is from the reference sequence of NM_006042. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GACTTTGGCTGGGATGGATAACCATATAATTTAAAAAGAAAAAAAAAATCAAAATATAATATATTTTTTT
  ACCAATCGGTAGAGAAGAGACAGTTTAATATTTGTGCTGAAAATATGTTTCAGTATTTTTTTCAATGAAT
  GTTAAGAGATTGTTCTCACTCCCGCCCCATCTTAATGTATAACCAACACCAAACACGTGGATCAACAGAA
  AAGGAAAATTTCACTCGTCTAAACACTTTCAATTTTCAGTTTTTATTTTATGTTCTATATACCCAGTCAT
  AAAGTATAAGCATCAGTTGTCATTAAAAGTTTTCAGAAAATCTTGAGGTTAAACATCTCTCTCTCTTTTT
  TTAAAATACAAGGCCCTGATAAAATTGATATCTATCCTTATATTTTTCTCCCTTTTTCCCGTGCCACTTT
  TTCTTAAATTATTTCCCAGTTAGTATTATCATATGTTTGTACCCGTCACAGTTTTCATAGTGCTTTCAAA
  TACACCTTTTTGA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_006042.1
• Summary: Heparan sulfate biosynthetic enzymes are key components in generating a myriad of distinct heparan sulfate fine structures that carry out multiple biologic activities. The enzyme encoded by this gene is a member of the heparan sulfate biosynthetic enzyme family. It is a type II integral membrane protein and possesses heparan sulfate glucosaminyl 3-O-sulfotransferase activity. The sulfotransferase domain of this enzyme is highly similar to the same domain of heparan sulfate D-glucosaminyl 3-O-sulfotransferase 3B1, and these two enzymes sulfate an identical disaccharide. This gene is widely expressed, with the most abundant expression in liver and placenta. [provided by RefSeq, Dec 2014]
• Locus ID: 9955