HS3ST3B1 (NM_006041) Human 3' UTR Clone

CAT#: SC207108

3`UTR clone of heparan sulfate (glucosamine) 3-O-sulfotransferase 3B1 (HS3ST3B1) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: HS3ST3B1
• Synonyms: 3-OST-3B; 3OST3B1; h3-OST-3B
• ACCN: NM_006041
• Insert Size: 527
• Sequence Data:
  Insert Sequence

  >SC207108 3'UTR clone of NM_006041
  The sequence shown below is from the reference sequence of NM_006041. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CACGACTTTGGCTGGGATTGAGCAGACCCGGGCTATGTACCTTACCCACGTGGCTTATCTATTGACAGAG
  ATTATATGTATGTAAAATGTACAGAAATCTATTTTATAATAATTTATTTTTAATTCATAAGCAATTAATT
  CACTAAGCTGCCTAGCCACACTCTTTAGAGAGTTAGCTTCATAATCTGTTAACATTCCAAAGTGTTTAAC
  TCTAGTATTTCGTTTTCTTCTTCACAATTGATGGTGCTTCTATTTTTTCTTCTCCCCTACCTGTTATATT
  TAAAACAAAGAAAAGCACAACTTGAGATTTTTGTTGTTACGGGTATTCAGCCTTCAGTCACCGTCTGAGT
  TCTCCAGTTGCTGCCTCCTTGTCTTGTCTTGGGTCTCCCATTCCAGCTTCCCTGTCTCTTCCTGCCTGTG
  TACCTCGTAGGAACGCTGAGCTGCCTCAACAGGGCTGTATTCTGAAGGGCAGGCCTCATGCAGCAGCCTC
  CTTGCAGATGTGGTGTCCCGTCCAATGATGTAGCCTG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_006041.1
• Summary: The protein encoded by this gene is a type II integral membrane protein that belongs to the 3-O-sulfotransferases family. These proteins catalyze the addition of sulfate groups at the 3-OH position of glucosamine in heparan sulfate. The substrate specificity of individual members of the family is based on prior modification of the heparan sulfate chain, thus allowing different members of the family to generate binding sites for different proteins on the same heparan sulfate chain. Following treatment with a histone deacetylase inhibitor, expression of this gene is activated in a pancreatic cell line. The increased expression results in promotion of the epithelial-mesenchymal transition. In addition, the modification catalyzed by this protein allows herpes simplex virus membrane fusion and penetration. A very closely related homolog with an almost identical sulfotransferase domain maps less than 1 Mb away. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
• Locus ID: 9953