EXOSC1 (NM_016046) Human 3' UTR Clone

CAT#: SC207185

3`UTR clone of exosome component 1 (EXOSC1) for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "EXOSC1"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol EXOSC1
Synonyms CGI-108; CSL4; Csl4p; hCsl4p; p13; SKI4; Ski4p
ACCN NM_016046
Insert Size 552
Sequence Data
>SC207185 3'UTR clone of NM_016046
The sequence shown below is from the reference sequence of NM_016046. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GGAAAGTAGCCCGAGTACAACCCGAATTCTTGCAGACCTAAGAAGCCACTTTTTACCCTATGGAAGGGGG
TAAGCTGTTCCTGAGTATAACACCAAGATGCTGCTGTCTTTATTCAAACACCTGGCGTCGGCCAACAGCC
ACTTCCAGAAAAATCTTCCAGTTTACGCTGTAGATGGAACATGTTTCTGTGAACCTATCAGTGGATTTCA
TTCTCTTGAGTAATAAATCTTATCTTTTCAAGGCACCAACAAACAAAACTGTGATATTGGAAATAGCCTA
TCCCTCCTGACAGTCCTTATAAATACATATTTTTTGCTATGATAAAACTTTTTTACTAAAAGGATGTTAT
AGAGTCTGTTGTCTTAAGCAGAGAAAGACATCTAAATGGTGTCAGGACATTTCAGTACTTCTGCTTATTG
AGTACTTACTGTGCTAGGCACTGAGTCAGGTGCTTTACATACGTCCCCTTCATTTAGGTACATTGTGATT
TAATGAAAATTTGAGGACACGTGGTGATACAGATAGCATGTGAGGCAGGCATGGTGGCTCAT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_016046.3
Summary This gene encodes a core component of the exosome. The mammalian exosome is required for rapid degradation of AU rich element-containing RNAs but not for poly(A) shortening. The association of this protein with the exosome is mediated by protein-protein interactions with ribosomal RNA-processing protein 42 and ribosomal RNA-processing protein 46. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2016]
Locus ID 51013

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.