PDE6D (NM_002601) Human 3' UTR Clone

CAT#: SC207196

3`UTR clone of phosphodiesterase 6D cGMP-specific rod delta (PDE6D) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: PDE6D
• Synonyms: JBTS22; PDED
• ACCN: NM_002601
• Insert Size: 548 bp
• Sequence Data:
  Insert Sequence

  >SC207196 3'UTR clone of NM_002601
  The sequence shown below is from the reference sequence of NM_002601. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  AGCACATCCAGAGTGAGACTTTTCTATGTTTGAAAGAAGAATGTGTGTACATTTCAAGAATTTGGGTTTT
  TTGGAGGGAGGAGGAAACTGTTTACTTTTTTCCTCCACACGTTTGATTTTTGACACATACACCCCTAATT
  CCCTCAACAGCAGAACCTACCTGCAGCCACCAGGGGACCAGCTCTGTGTAGGTAACCAGATGGCTCTTTT
  TCCCAAGCCACCATCTTCCAGCTGACCAGACTAAACTCCCAACCCCAGACCAGGGCAGGGGACAGGTCTC
  AAGTCCTTCCCAGCATACACACAGGGAACAAACACATACCACAAACCGGTAACTGTACCTGTCACCCTCC
  TTGTCTCCTCCTTGGGCCCTACAGGCTACACATCTACCTTTGGCCCCTGGTTTTGGAAAAATTCCGTGTT
  CCTGACCCATGTTTAGTTTTTTCCTACCATTTCTATTTCATACATTCTCATACATTTAACTTGTAAAATA
  GACTGTGATATTATTACATAATGTAATTAAAAATATGAATTAAAATATTCCTACAGTC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_002601.2
• Summary: 'This gene encodes the delta subunit of rod-specific photoreceptor phosphodiesterase (PDE), a key enzyme in the phototransduction cascade. A similar protein in cow functions in solubilizing membrane-bound PDE. In addition to its role in the PDE complex, the encoded protein is thought to bind to prenyl groups of proteins to target them to subcellular organelles called cilia. Mutations in this gene are associated with Joubert syndrome-22. Alternative splicing results in multiple splice variants. [provided by RefSeq, Mar 2014]'
• Locus ID: 5147