C1GALT1C1 (NM_152692) Human 3' UTR Clone

CAT#: SC207335

3`UTR clone of C1GALT1-specific chaperone 1 (C1GALT1C1) transcript variant 1 for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "C1GALT1C1"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol C1GALT1C1
Synonyms C1GALT2; C38H2-L1; COSMC; HSPC067; MST143; TNPS
ACCN NM_152692
Insert Size 554
Sequence Data
>SC207335 3'UTR clone of NM_152692
The sequence shown below is from the reference sequence of NM_152692. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GCATTGGTTTTCTTACCTCCAAATGGTTCTGACAATGACTGAGAAGTGGTAGAAAAGCGTGAATATGATC
TTTGTATAGGACGTGTGTTGTCATTATTTGTAGTAGTAACTACATATCCAATACAGCTGTATGTTTCTTT
TTCTTTTCTAATTTGGTGGCACTGGTATAACCACACATTAAAGTCAGTAGTACATTTTTAAATGAGGGTG
GTTTTTTTCTTTAAAACACATGAACATTGTAAATGTGTTGGAAAGAAGTGTTTTAAGAATAATAATTTTG
CAAATAAACTATTAATAAATATTATATGTGATAAATTCTAAATTATGAACATTAGAAATCTGTGGGGCAC
ATATTTTTGCTGATTGGTTAAAAAATTTTAACAGGTCTTTAGCGTTCTAAGATATGCAAATGATATCTCT
AGTTGTGAATTTGTGATTAAAGTAAAACTTTTAGCTGTGTGTTCCCTTTACTTCTAATACTGATTTATGT
TCTAAGCCTCCCCAAGTTCCAATGGATTTGCCTTCTCAAAATGTACAACTAAGCAACTAAAGAA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_152692.4
Summary This gene encodes a type II transmembrane protein that is similar to the core 1 beta1,3-galactosyltransferase 1, which catalyzes the synthesis of the core-1 structure, also known as Thomsen-Friedenreich antigen, on O-linked glycans. This gene product lacks the galactosyltransferase activity itself, but instead acts as a molecular chaperone required for the folding, stability and full activity of the core 1 beta1,3-galactosyltransferase 1. Mutations in this gene have been associated with Tn syndrome. Alternatively spliced transcript variants encoding the same protein have been identified. [provided by RefSeq, Dec 2009]
Locus ID 29071

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.