Osteopontin (SPP1) (NM_000582) Human 3' UTR Clone

CAT#: SC207353

3`UTR clone of secreted phosphoprotein 1 (SPP1) transcript variant 2 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "SPP1"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol SPP1
Synonyms BNSP; BSPI; ETA-1; OPN
ACCN NM_000582
Insert Size 514 bp
Sequence Data
>SC207353 3'UTR clone of NM_000582
The sequence shown below is from the reference sequence of NM_000582. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

AGATAGTGCATCTTCTGAGGTCAATTAAAAGGAGAAAAAATACAATTTCTCACTTTGCATTTAGTCAAAA
GAAAAAATGCTTTATAGCAAAATGAAAGAGAACATGAAATGCTTCTTTCTCAGTTTATTGGTTGAATGTG
TATCTATTTGAGTCTGGAAATAACTAATGTGTTTGATAATTAGTTTAGTTTGTGGCTTCATGGAAACTCC
CTGTAAACTAAAAGCTTCAGGGTTATGTCTATGTTCATTCTATAGAAGAAATGCAAACTATCACTGTATT
TTAATATTTGTTATTCTCTCATGAATAGAAATTTATGTAGAAGCAAACAAAATACTTTTACCCACTTAAA
AAGAGAATATAACATTTTATGTCACTATAATCTTTTGTTTTTTAAGTTAGTGTATATTTTGTTGTGATTA
TCTTTTTGTGGTGTGAATAAATCTTTTATCTTGAATGTAATAAGAATTTGGTGGTGTCAATTGCTTATTT
GTTTTCCCACGGTTGTCCAGCAAT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_000582.2
Summary 'The protein encoded by this gene is involved in the attachment of osteoclasts to the mineralized bone matrix. The encoded protein is secreted and binds hydroxyapatite with high affinity. The osteoclast vitronectin receptor is found in the cell membrane and may be involved in the binding to this protein. This protein is also a cytokine that upregulates expression of interferon-gamma and interleukin-12. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]'
Locus ID 6696

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.