CDC34 (NM_004359) Human 3' UTR Clone

CAT#: SC207404

3`UTR clone of cell division cycle 34 homolog (S. cerevisiae) (CDC34) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CDC34
• Synonyms: E2-CDC34; UBC3; UBCH3; UBE2R1
• ACCN: NM_004359
• Insert Size: 539 bp
• Sequence Data:
  Insert Sequence

  >SC207404 3'UTR clone of NM_004359
  The sequence shown below is from the reference sequence of NM_004359. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TGAGGATGACTCTGGCACGGAGGAGTCCTGACACCACCAGAATAAACTTGCCGAGTTTACCTCACTAGGG
  CCGGACCCGTGGCTCCTTAGACGACAGACTACCTCACGGAGGTTTTGTGCTGGTCCCCGTCTCCTCTGGT
  TGTTTCGTTTTGGCTTTTTCTCCCTCCCCATGTCTGTTCTGGGTTTTCACGTGCTTCAGAGAAGAGGGGC
  TGCCCCACCGCCACTCACGTCACTCGGGGCTCGGTGGACGGGCCCAGGGTGGGAGCGGCCGGCCCACCTG
  TCCCCTCGGGAGGGGAGCTGAGCCCGACTTCTACCGGGGTCCCCCAGCTTCCGGACTGGCCGCACCCCGG
  AGGAGCCACGGGGGCGCTGCTGGGAACGTGGGCGGGGGGCCGTTTCCTGACACTACCAGCCTGGGAGGCC
  CAGGTGTAGCGGTCCGAGGGGCCCGGTCCTGCCTGTCAGCTCCAGGTCCTGGAGCCACGTCCAGCACAGA
  GTGGACGGATTCACCGTGGCCGACTCTTTTCCCTGCTTTGGTTTGTTTG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_004359.1
• Summary: 'The protein encoded by this gene is a member of the ubiquitin-conjugating enzyme family. Ubiquitin-conjugating enzyme catalyzes the covalent attachment of ubiquitin to other proteins. This protein is a part of the large multiprotein complex, which is required for ubiquitin-mediated degradation of cell cycle G1 regulators, and for the initiation of DNA replication. [provided by RefSeq, Jul 2008]'
• Locus ID: 997