XRCC4 (NM_022406) Human 3' UTR Clone

CAT#: SC207434

3`UTR clone of X-ray repair complementing defective repair in Chinese hamster cells 4 (XRCC4) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: XRCC4
• Synonyms: SSMED
• ACCN: NM_022406
• Insert Size: 534 bp
• Sequence Data:
  Insert Sequence

  >SC207434 3'UTR clone of NM_022406
  The sequence shown below is from the reference sequence of NM_022406. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GAAACAGCAGCCCAGAAGACCTCTTTGATGAGATTTAACAGTCTCAAAAAATACTTTGATGTTCACTAGA
  CTATGTTTTCTATTCATTTCTTTAAAATGAAAAAGGAGAATTTCAAGTCAGCAGCCGCTATTACCGTATC
  TTACAATTTAATTACATACACAGTGAATTGAAACCATTGTGCAAAATGGATTACACATGTATACAAAGAT
  ACGATTTGATGATGACACTGGCACATTATTCTAAACTATTCATTCAGCATGCCTATAATTACATAAATTG
  TATGAGACTTTTTGTTGCAAAGGACACATTTATCATATTCATTCACACATATTATATGTGATAGCTGTCC
  AACATCCTGTCTGGGAAGATTTTGAAAACAGGACAAAGAAAACATCATTTTAAAATGTCTTCAGCTTTTT
  TTGAATAGACGTATTCAAACATATTCTGAACATTGATGTTTGAACATTTTAATTTGTGTGATGATGTAGA
  AAATATAATTTTAGTTTGTACATAAACATTGTGAAAATCTGATA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_022406.2
• Summary: 'The protein encoded by this gene functions together with DNA ligase IV and the DNA-dependent protein kinase in the repair of DNA double-strand breaks. This protein plays a role in both non-homologous end joining and the completion of V(D)J recombination. Mutations in this gene can cause short stature, microcephaly, and endocrine dysfunction (SSMED). Alternate transcript variants such as NM_022406 are unlikely to be expressed in some individuals due to a polymorphism (rs1805377) in the last splice acceptor site. [provided by RefSeq, Oct 2019]'
• Locus ID: 7518