RNA Helicase A (DHX9) (NM_001357) Human 3' UTR Clone

CAT#: SC207446

3`UTR clone of DEAH (Asp-Glu-Ala-His) box polypeptide 9 (DHX9) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: DHX9
• Synonyms: DDX9; LKP; NDH2; NDHII; RHA
• ACCN: NM_001357
• Insert Size: 564 bp
• Sequence Data:
  Insert Sequence

  >SC207446 3'UTR clone of NM_001357
  The sequence shown below is from the reference sequence of NM_001357. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  ACTGGCTACTTTGGACAGGGAAGAGGAGGTGGCGGCTATTAAAACTTGGTTATGTCAGTTCCTGTGTGTA
  GACAGTAAGGAAAAAAAGGCATGCTATGTGTTACGTGTTTTTTCCAGTATGTTTATTTGCCACCAAAAAG
  TAAATGCATTTTCACCCATTCTGTGGTTCATTGTAGTTTAAGGAAACCAAGCATATAGATGCATTAGTGA
  TTTTGTTTATATTATGTAAAATATAACGATCTCTTAAAAATACCACAGTTTGTATTTTTTCTTTAAGGAG
  TAAAGATTTGCCTTTAAATAACTTGGTATTTTCCTGGCTTTCGTTTAATACAATAGAAAATAAAGTATTA
  CACCGAATACTTGCCGTGTAGTTTGTTTGTTGACCTCGTATGTTAGAAAATTTTACAATGCCAGCTACAT
  CTGTTGATTTTAAATGTCAGAGAAGTTGTACCCTGTTTCAAAAGTATACTAAGTGATACTACTTGTAATA
  GAATAAATCATCTTGGAATTGAATTGTTACCTTTTGAAGTAAATACTGGCAAGTGCACAAGCCACATAAA
  CCTG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001357.4
• Summary: 'This gene encodes a member of the DEAH-containing family of RNA helicases. The encoded protein is an enzyme that catalyzes the ATP-dependent unwinding of double-stranded RNA and DNA-RNA complexes. This protein localizes to both the nucleus and the cytoplasm and functions as a transcriptional regulator. This protein may also be involved in the expression and nuclear export of retroviral RNAs. Alternate splicing results in multiple transcript variants. Pseudogenes of this gene are found on chromosomes 11 and 13.[provided by RefSeq, Feb 2010]'
• Locus ID: 1660