TNR (NM_003285) Human 3' UTR Clone

CAT#: SC207481

3`UTR clone of tenascin R (restrictin janusin) (TNR) for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol TNR
Synonyms TN-R
ACCN NM_003285
Insert Size 583 bp
Sequence Data
>SC207481 3'UTR clone of NM_003285
The sequence shown below is from the reference sequence of NM_003285. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GGAGAAAACGGCAGTCCTTACAGTTCTGAGCAGTGGGCGGCTGCAAGCCAACCAATATTTTCTGTCATTT
GTTTGTATTTTATAATATGAAACAAGGGGGGAGGGTAATAGCAATGTGTTTTGCAACATATTAAGAGTAT
GTGAAGGAAGCAGGGATGTCGCAGGAATCCGCTGGCTAACATCTGCTCTTGGTTTCTGCTGCCCTGGAGC
CTGACCCTCAGTCTCCATTCTCCCTCCTACCCAGGCCTCCTCAACCTTCACCTCCTTTCCCACCAAGGAG
GAGAAGTAGGAAGTTTTCTTAAAGGGCCAATTCAAAGCCAAGTCGTGGGGTGCAGATTGTTATGGTGACA
GGCACACACATTTTTCTACCCTTCTTCTGAGATGTCCTCTGCCTTCCAGGTATTTGTGATTTTGTCACAG
CCTGACATGGCCAGGTTCTCACACTGGCCCAGAGAAAAGAGCCTCAGCAAGAGAGTTTTGCCAACAATTC
CCCTTAAAAGGAAACAGATCAACTACACCGCATCCCAACAACCCAGGTTCTTTTCCTTCCTTCCTTCCTT
CCTCCCTTCCTTCTTTCCTGCCT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_003285.2
Summary 'This gene encodes a member of the tenascin family of extracellular matrix glycoproteins. The encoded protein is restricted to the central nervous system. The protein may play a role in neurite outgrowth, neural cell adhesion and modulation of sodium channel function. It is a constituent of perineuronal nets. [provided by RefSeq, Aug 2013]'
Locus ID 7143

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.