GADD45A (NM_001924) Human 3' UTR Clone

CAT#: SC207529

3`UTR clone of growth arrest and DNA-damage-inducible alpha (GADD45A) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: GADD45A
• Synonyms: DDIT1; GADD45
• ACCN: NM_001924
• Insert Size: 561 bp
• Sequence Data:
  Insert Sequence

  >SC207529 3'UTR clone of NM_001924
  The sequence shown below is from the reference sequence of NM_001924. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  AATCTCCCTGAACGGTGATGGCATCTGAATGAAAATAACTGAACCAAATTGCACTGAAGTTTTTGAAATA
  CCTTTGTAGTTACTCAAGCAGTTACTCCCTACACTGATGCAAGGATTACAGAAACTGATGCCAAGGGGCT
  GAGTGAGTTCAACTACATGTTCTGGGGGCCCGGAGATAGATGACTTTGCAGATGGAAAGAGGTGAAAATG
  AAGAAGGAAGCTGTGTTGAAACAGAAAAATAAGTCAAAAGGAACAAAAATTACAAAGAACCATGCAGGAA
  GGAAAACTATGTATTAATTTAGAATGGTTGAGTTACATTAAAATAAACCAAATATGTTAAAGTTTAAGTG
  TGCAGCCATAGTTTGGGTATTTTTGGTTTATATGCCCTCAAGTAAAAGAAAAGCCGAAAGGGTTAATCAT
  ATTTGAAAACCATATTTTATTGTATTTTGATGAGATATTAAATTCTCAAAGTTTTATTATAAATTCTACT
  AAGTTATTTTATGACATGAAAAGTTATTTATGCTATAAATTTTTTGAAACACAATACCTACAATAAACTG
  G
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001924.2
• Summary: 'This gene is a member of a group of genes whose transcript levels are increased following stressful growth arrest conditions and treatment with DNA-damaging agents. The protein encoded by this gene responds to environmental stresses by mediating activation of the p38/JNK pathway via MTK1/MEKK4 kinase. The DNA damage-induced transcription of this gene is mediated by both p53-dependent and -independent mechanisms. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene.[provided by RefSeq, Dec 2010]'
• Locus ID: 1647