DNA Ligase III (LIG3) (NM_013975) Human 3' UTR Clone

CAT#: SC207544

3`UTR clone of ligase III DNA ATP-dependent (LIG3) nuclear gene encoding mitochondrial protein transcript variant alpha for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: LIG3
• Synonyms: LIG2; LIG3alpha
• ACCN: NM_013975
• Insert Size: 564 bp
• Sequence Data:
  Insert Sequence

  >SC207544 3'UTR clone of NM_013975
  The sequence shown below is from the reference sequence of NM_013975. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GAAACGGAGACTGGTAGCTCCCTGCTAGGTTTGCTGTCTTCCCTCTCCCTCAGGCCATACTCTCCTTTAC
  CATACTACTGGACTGGACTCAGGCTGGAGGCAGATAGACACAGTATAGGGGGAATGGGCTTGCTTCTCCC
  AAACCCACCAGTTCTCCACTGTCTCTTCTGGACCAGGAATTAGTTGCTGTGGGTGCCACAGCTGAAGTCA
  GTTTGTCTTGCTGGTTTAAATAGATCTTTCAGAGCTGGGTGCTGGGTTTGCCATCTTTTTGTTTTCTTTG
  AAAAGCAGCTTAGTTACCCTTTTTATAAATAAAATATCTTGCAGTTATCTTTGTCCTTTCCCCACCTACA
  CCCCCAATAATTTCCCTAGAGATTAAGGAGTAAAGGCTGGGCTATGGCAGCTCTGTCCACAAAGCCTTCT
  CTCCCATCCTTGCCTGTTCCTTTGTACTTCCAGGCTCATTTTAAAGTTGTATTTAAAGGACTGCCCTCGG
  AAATGCTTCTGTTTAGCGGAACTTGTATTCAGCCTGACACGCTTTGCCAGGAACAAACCTCATGTGAAAG
  AAAA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_013975.2
• Summary: 'This gene is a member of the DNA ligase family. Each member of this family encodes a protein that catalyzes the joining of DNA ends but they each have a distinct role in DNA metabolism. The protein encoded by this gene is involved in excision repair and is located in both the mitochondria and nucleus, with translation initiation from the upstream start codon allowing for transport to the mitochondria and translation initiation from a downstream start codon allowing for transport to the nucleus. Additionally, alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]'
• Locus ID: 3980