ARAP3 (NM_022481) Human 3' UTR Clone

CAT#: SC207589

3`UTR clone of ArfGAP with RhoGAP domain ankyrin repeat and PH domain 3 (ARAP3) for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "ARAP3"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol ARAP3
Synonyms CENTD3; DRAG1
ACCN NM_022481
Insert Size 591
Sequence Data
>SC207589 3'UTR clone of NM_022481
The sequence shown below is from the reference sequence of NM_022481. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CCATGCACTTCCAGTCCACCCTCCAGCCAGCCCCTCACATGACCCTAGGACCAGCAGTCTGAGAGGGTAG
GTACCAGAAGACCCAGAAACTCTTATCGTGGCACTGTTGCAGCTTCCTCTGCCCTGGCTGGAAAGACTCC
AGAATCCAGTGTGGTGCTGTGGAAGGAGCACTGGACTAAAGGCTTCAGTGGCTGCGTGTCCCAGGACAGG
TCATGGCCCCTCTCTGGGCCCAGCCCATTTATCTATACCATGAGGTAACTGAAGTAAGGAGAGCAGTGAA
TGTCAAACTGTGTTTCTTAGAGCCATAAGCCCCACATATTATCCCTGAACAAGGGCAGCTCCTGCTTTAT
ATATTTGATACGTAGGGGTTCCATGAGAGATTTTGGGTTTTAAAGGAATGGTTTTACTGCATTAAAGAAA
AAAAATGCTTTGGAAACCAGAGGCCTGGGTGATGTTAAAGTCTATCCTGTCCCACTTCCTACATTCTGGG
ACTACCGTGAAGCCTGGAGTAGGGAGAGCGAGTTTGGGAGCTGGGACTCGGGGAGTCAAAAATAGATGAG
TAATTGTCAATAAACCTGGGAACCAAAAGAC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_022481.5
Summary This gene encodes a phosphoinositide binding protein containing ARF-GAP, RHO-GAP, RAS-associating, and pleckstrin homology domains. The ARF-GAP and RHO-GAP domains cooperate in mediating rearrangements in the cell cytoskeleton and cell shape. It is a specific PtdIns(3,4,5)P3/PtdIns(3,4)P2-stimulated Arf6-GAP protein. An alternatively spliced transcript has been found for this gene, but its biological validity has not been determined. [provided by RefSeq, Sep 2015]
Locus ID 64411

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.