Syntaxin 5A (STX5) (NM_003164) Human 3' UTR Clone

CAT#: SC207620

3`UTR clone of syntaxin 5 (STX5) for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "STX5"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol STX5
Synonyms SED5; STX5A
ACCN NM_003164
Insert Size 593
Sequence Data
>SC207620 3'UTR clone of NM_003164
The sequence shown below is from the reference sequence of NM_003164. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CTTTGTGGTCTTCCTTGCTTGAACCCTCTCTACTCTGAGGCACTCTGTTGGGGTTTGGGACCCTCCTGGG
AAGGCAAGTGGCCAGTGCTGCCACTGAGCCTGTGCAGGGTACTTGGGAGAAAGGCCCTGTTTCCCTGGAA
CTGCTAAGAATGACCACTGCCCCTGATCCCCCACCCCTTGCCTCTGGCCACCCTGTCCTCCCCCCACCAC
CCTCAGGCCTATGAAACACACAGGGTTCTAGATTTGAACTCTGCTGTGAAGTGACTGGAAGGGAGCAGAG
GCCAGCTGGGGGCCAGTGGGGGAGGTTGTTTCCACTAGGAGATTTTTATAAACCCTCTCCAGCCTCTCCC
AAAGGAAGCGTTGGCAGCAAAGGGAGATGATGCCCTTACCCACCTTCCTGTGAGTGAAGAGAGGAAGCAG
CCCCAGGGACCAATTTTCCCAATTGACCTCTTTCTTCCTCTTTCACCATGTGAGGCAGGGAGCCCTGAGC
CCTTCAGCTGCCTGCACAACCCCTGACATTGGCTGCTGGTGACTCAATCTGCCAAATGTGCTGCAGCTCG
TTTTCTCCCAATTACAGCAAGACTGTCAGCCTC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_003164.3
Summary This gene encodes a member of the syntaxin or t-SNARE (target-SNAP receptor) family. These proteins are found on cell membranes and serve as the targets for v-SNAREs (vesicle-SNAP receptors), permitting specific synaptic vesicle docking and fusion. The encoded protein regulates endoplasmic reticulum to Golgi transport and plays a critical role in autophagy. Autoantibodies targeting the encoded protein may be a diagnostic marker for endometriosis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2011]
Locus ID 6811

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.