IFNGR2 (NM_005534) Human 3' UTR Clone

CAT#: SC207624

3`UTR clone of interferon gamma receptor 2 (interferon gamma transducer 1) (IFNGR2) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: IFNGR2
• Synonyms: AF-1; IFGR2; IFNGT1; IMD28
• ACCN: NM_005534
• Insert Size: 566 bp
• Sequence Data:
  Insert Sequence

  >SC207624 3'UTR clone of NM_005534
  The sequence shown below is from the reference sequence of NM_005534. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GAAGATGTTCTCCAAACGCTTTGAACCAAAGCATGGGCCTAGCCCACTGGCTCCCTGGAAGAGATCAAGC
  CATCGGAGCTGCTAGAGTTCTGTCTGGACTTTCCAGAGACCAGTATTCCCTTTTGCTGCCTCTAAAAGGC
  CTGTCCCTGCAGACATGAGAGACAGCAGGTCTCATGGGGGTGACAAGCTTTTTTTTTTTTTCTTAAAGAA
  TTTTCAAAATCAAATTCCAGAATGATTTTACGGAGATATCCCAGGAAAATTAAGGCTTCTCTTAAACACT
  AAAAAGGCATGTAATTGCTTGTTAGCAAAATGGATATGACACATCTCTGATACTTTTTTCATTATTGGTT
  GGGCTGAGCAGTCAGAAGACCTGGTCGTCGTCTTGACTTTGGCAAATGAGCCGGAGCCCCTTGGGCAGGT
  CACACAACCTGTCCCAGCGAGGGACACCGAGTGGCCCTTCATGTACATCCATGGTGTGCTGGCTTAAAAT
  GTAATTAATCTTGTAAATATACTCCTAGTAATTTAAGATTTTGTTTTTAAACTGGAAATAAAAGATTGTA
  TAGTGC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_005534.3
• Summary: 'This gene (IFNGR2) encodes the non-ligand-binding beta chain of the gamma interferon receptor. Human interferon-gamma receptor is a heterodimer of IFNGR1 and IFNGR2. Defects in IFNGR2 are a cause of mendelian susceptibility to mycobacterial disease (MSMD), also known as familial disseminated atypical mycobacterial infection. MSMD is a genetically heterogeneous disease with autosomal recessive, autosomal dominant or X-linked inheritance. [provided by RefSeq, Jul 2008]'
• Locus ID: 3460