DIS3L2 (NM_152383) Human 3' UTR Clone

CAT#: SC207629

3`UTR clone of DIS3 mitotic control homolog (S. cerevisiae)-like 2 (DIS3L2) for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "DIS3L2"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol DIS3L2
Synonyms FAM6A; hDIS3L2; PRLMNS
ACCN NM_152383
Insert Size 559
Sequence Data
>SC207629 3'UTR clone of NM_152383
The sequence shown below is from the reference sequence of NM_152383. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

AGGACTCAAGCACCAGCTGAGCTCCACCAGCCGCCTGCCCCGCCTGCCCCGCCTGCCTGTCCCGCCACAC
TGGCTTTAGGACCTGTTGACACGGAGGGGGGTTTTTAATTTGGTTTTTAACAACTCAGGGGTTTGTTTTT
ATTTTTATTTAATTTTTGCAGCTCAACTTTTAAACAAACTGCAGGGGAGAGGGTGGGGCTGGAAGGAAGG
CTGAGGCCTGGTCAGCAGTGACCCCAGCAGAGCAGGCCCCAGTCCTCCTGGGAGGCTGGCCCCCCTTTTT
TCTGGGCCCTACTGCCCTCCTCTGCCCAGGAAATGGGGGGGTTTCAGCAACTCAGTGTCACAGAATAAAA
TCAAGTGTGGAGTGCCATCTGGTGTGTAGGGCGCCTCTGGGAAGCCTGGGCAGCAGAATGCCCCTTGCAC
CCAGGGCAAGGGACCCAGTTCAGGCTTCACCCCTCGCTGCTGAGCCGATGTCAACACCTGGAACTTTCCT
GTCAGTTCCAACACGATTCAGAGCTGGCTGCCTGGCAGATGATTGATACTGGAGTCTCATTCTGCCTGA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_152383.4
Summary The protein encoded by this gene is similar in sequence to 3'/5' exonucleolytic subunits of the RNA exosome. The exosome is a large multimeric ribonucleotide complex responsible for degrading various RNA substrates. Several transcript variants, some protein-coding and some not, have been found for this gene. [provided by RefSeq, Mar 2012]
Locus ID 129563

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.