GRIK5 (NM_002088) Human 3' UTR Clone

CAT#: SC207674

3`UTR clone of glutamate receptor ionotropic kainate 5 (GRIK5) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: GRIK5
• Synonyms: EAA2; GluK5; GRIK2; KA2
• ACCN: NM_002088
• Insert Size: 541 bp
• Sequence Data:
  Insert Sequence

  >SC207674 3'UTR clone of NM_002088
  The sequence shown below is from the reference sequence of NM_002088. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TGGCGGAGCACGAGTGACCACGGGCGGGGCTGTGCGGGCGCCCGGACTGACCGAAGGGACGGGGCCCGCC
  CCAGGCCCCAGCAGTCTCCGCTCCCGCAGCGGGCGCGGGACAGGACTTGTGCGCCGGCGCCCCGGACGCC
  GCGATTTTGCCTTTGGTTCCCCGCGAAGTCCGAGGCCTGGCTCTGGAGCCCGCCTGCGCCCCCCAGTGGA
  CTCGCGAGAGGGTGCCGCGGGCGAGAAGGGCGCAGGAACCGAGGACTCCAGGGGCTGGGGACTTCGGGGG
  CGGCTCTGGGAAGCGGAAAGCAGTCAGCGGAGAGGACCCCATTCTGGGACTGCTCAGGCTCCCCAAGACT
  TGACGCAGCCCCCCACGCTTCTGGAGGTGGGGAGGGCCTCTGGACAGATGGGTGTCCCCTGGTGCCCCTC
  CACTCTTCTCTTCCTCTCTTTTTTGGGGGGAGAAACCTCGGAATTTCTATGAGACCTCCCCCAGGGAGGG
  GGTCAGTTGGGCCCCCATCCCTCCCCTTGCCACATCGCAGCCCCTGTTGGA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_002088.3
• Summary: 'This gene encodes a protein that belongs to the glutamate-gated ionic channel family. Glutamate functions as the major excitatory neurotransmitter in the central nervous system through activation of ligand-gated ion channels and G protein-coupled membrane receptors. The protein encoded by this gene forms functional heteromeric kainate-preferring ionic channels with the subunits encoded by related gene family members. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]'
• Locus ID: 2901