ACADS (NM_000017) Human 3' UTR Clone

CAT#: SC207678

3`UTR clone of acyl-Coenzyme A dehydrogenase C-2 to C-3 short chain (ACADS) nuclear gene encoding mitochondrial protein for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "ACADS"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol ACADS
Synonyms ACAD3; SCAD
ACCN NM_000017
Insert Size 563 bp
Sequence Data
>SC207678 3'UTR clone of NM_000017
The sequence shown below is from the reference sequence of NM_000017. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GGCATCTGCTCAGGAGCTACCGGAGCTGAGCCCGCGGCGGACTGCCCCAGGACTGCGGGAAGGCGCGGGA
GCCAGGGGCCTCCACCCCAACCCCGGCTCAGAGACTGGGCGGCCCGGCGGGGGCTCCCTGGGGACCCCAG
ATGGGCTCAGTGCTGCCACCCAGATCAGATCACATGGGAATGAGGCCCTCCGACCATTGGCAGCTCCGCC
TCTGGGCCTTTCCGCCTCCTCACCACTGTGCCTCAAGTTCCTCATCTAAGTGGCCCTGGCCTCCTGGGGG
CGGGGTTGTGGGGGGGCTGAGCGACACTCAGGGACACCTCAGTTGTCCTCCCGCGGGCCCTGGTGCCCTG
GCATGAAGGCCCAGTGCGACAGGCCCTTGGTGGGGTCTGTCTTTTCCTTGAGGTCAGAGGTCAGGAGCAG
GGCTGGGGTCAGGATGACGAGGCCTGGGGTCCTGGTGTTGGGCAGGTGGTGGGGCTGGGCCATGGAGCTG
GCCCAGAGGCCCCTCAGCCCTTTGTAAAGTCTGATGAAGGCAGGGGTGGTGATTCATGCTGTGTGACTGA
CTG

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_000017.2
Summary This gene encodes a tetrameric mitochondrial flavoprotein, which is a member of the acyl-CoA dehydrogenase family. This enzyme catalyzes the initial step of the mitochondrial fatty acid beta-oxidation pathway. Mutations in this gene have been associated with short-chain acyl-CoA dehydrogenase (SCAD) deficiency. Alternative splicing results in two variants which encode different isoforms. [provided by RefSeq, Oct 2014]
Locus ID 35

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.