MRPS18C (NM_016067) Human 3' UTR Clone

CAT#: SC207704

3`UTR clone of mitochondrial ribosomal protein S18C (MRPS18C) nuclear gene encoding mitochondrial protein for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: MRPS18C
• Synonyms: CGI-134; MRP-S18-1; MRP-S18-c; MRPS18-1; mrps18-c; S18mt-c
• ACCN: NM_016067
• Insert Size: 598
• Sequence Data:
  Insert Sequence

  >SC207704 3'UTR clone of NM_016067
  The sequence shown below is from the reference sequence of NM_016067. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TCTCAAGGACCCTAAAGTTTGTAACATCAGATATCGGGAATAAATTCTATCACGTTACCACTAATAAACT
  TATTTTACAGTAAGTGGTTGTATGATGCCAATACTGACTCAAACCAACCTTTGGATAGAAAAGTGTTTGA
  GGAGTGAGGTAAAGAATGACACTTCCCCTTCATACCAATGTCCATTAAGCAGATTGCTTATTTAAAATGT
  TAACACTCATCACATTTTATCTATGTTGAATAAAAGTGGTTCTGTGTGATTGTCATTTATATCTGATCCC
  CAAATAGCTCATACAATAATCCATTCAATAGAATGGAATTAAAACTGTTCAGAATGATTTTCCAACTAGC
  AAATATAAGTATGCCTGGTTAAGATATCTTCCCTTTGTAGAAATGTTACATTGGGATGGATAGTGGTGCT
  GTCACAGAAGGACAAAATATTCCTAGACGAGTCTACCCTCAAACCAGTAGTGTCTTTTACATGAAGAGAT
  GATTTACACCTAATAGACATTGAATATGATAGACATACATGTATATATGTATCAGTTCTGAGTTCCACTG
  GCCTATCCCAAATACACTGGATTACCAGGCTTGTACTG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_016067.2
• Summary: Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein that belongs to the ribosomal protein S18P family. The encoded protein is one of three that has significant sequence similarity to bacterial S18 proteins. The primary sequences of the three human mitochondrial S18 proteins are no more closely related to each other than they are to the prokaryotic S18 proteins. Pseudogenes corresponding to this gene are found on chromosomes 8p, 12p, 15q, and 22q. [provided by RefSeq, Jul 2008]
• Locus ID: 51023