PGM1 (NM_002633) Human 3' UTR Clone

CAT#: SC207769

3`UTR clone of phosphoglucomutase 1 (PGM1) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: PGM1
• Synonyms: CDG1T; GSD14
• ACCN: NM_002633
• Insert Size: 564 bp
• Sequence Data:
  Insert Sequence

  >SC207769 3'UTR clone of NM_002633
  The sequence shown below is from the reference sequence of NM_002633. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  ACCCACTGTCATCACCTAAGAAGACAGGCCTGATGTGGTACGTCCCTCCACCCCCGGACCCATCCAAGTC
  ATCTGATTGAAGAGCATGACAGAAACAAAATGTATTCACCAAGCATTTTAGGATTTGACTTTTTCACTAA
  CCAGTTGACGAGCAGTGCATTTACAAGGCACTGCCAAACAAGATGCCCTTGGGAGCTGTGAGGGAAAGAG
  GACCTGCGGGCTTAGATCAATCTCAATTCCTTTTCATGCCCTCCTGCATTGCTGCTGCGTGGGTATTTGT
  CTCCTTAGCCATCAGGTACAGTTTACACTACAATGTAAGCTATAGGTGGAGCATCAGCAGTGAGTGAGGC
  CATTCTTCATCCTTAGGATGTGGCAATGAAATGATGGTGCAAGTTCCTTTCTCTTTTGTGAATCTTTCCC
  CCCATTTCCTGTTTACATGTAACCCAACAAAATGCAATTTCTAGTGCCTTCTGTCCAATCAGTTCTTTCC
  TCTGAGTGAGACGTACTTGGCTACAGATTTCTGCCTTGTTTTGCGACATTGTCCCATTCACACAGATATT
  TTGG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_002633.2
• Summary: 'The protein encoded by this gene is an isozyme of phosphoglucomutase (PGM) and belongs to the phosphohexose mutase family. There are several PGM isozymes, which are encoded by different genes and catalyze the transfer of phosphate between the 1 and 6 positions of glucose. In most cell types, this PGM isozyme is predominant, representing about 90% of total PGM activity. In red cells, PGM2 is a major isozyme. This gene is highly polymorphic. Mutations in this gene cause glycogen storage disease type 14. Alternativley spliced transcript variants encoding different isoforms have been identified in this gene.[provided by RefSeq, Mar 2010]'
• Locus ID: 5236