MEK6 (MAP2K6) (NM_002758) Human 3' UTR Clone

CAT#: SC207779

3`UTR clone of mitogen-activated protein kinase kinase 6 (MAP2K6) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: MAP2K6
• Synonyms: MAPKK6; MEK6; MKK6; PRKMK6; SAPKK-3; SAPKK3
• ACCN: NM_002758
• Insert Size: 601 bp
• Sequence Data:
  Insert Sequence

  >SC207779 3'UTR clone of NM_002758
  The sequence shown below is from the reference sequence of NM_002758. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  AAGGAACAGATGTGGCATCTTTTGTAAAACTGATTCTTGGAGACTAAAAAGCAGTGGACTTAATCGGTTG
  ACCCTACTGTGGATTGGTGGGTTTCGGGGTGAAGCAAGTTCACTACAGCATCAATAGAAAGTCATCTTTG
  AGATAATTTAACCCTGCCTCTCAGAGGGTTTTCTCTCCCAATTTTCTTTTTACTCCCCCTCTTAAGGGGG
  CCTTGGAATCTATAGTATAGAATGAACTGTCTAGATGGATGAATTATGATAAAGGCTTAGGACTTCAAAA
  GGTGATTAAATATTTAATGATGTGTCATATGAGTCCTCAAGCTTCTCAGACTTCTCTTATTCTTTACAAA
  ATGAATGCATTGGCCCTGACAAAAAGGTGCTACGGTAGTGATGAAATTATAAGTAGATTTGTAGTTTGTC
  CCATTTATTATTTTAATATTTATGTTTAAGTGCTTGGTTGAAAAGATTCCATTTTATACAAGAAGGGAGA
  TTCAAAAAAAAAATATAAGGTTGGGTTAGCAATATTTATAGGGCTTTTATTTTTTAAGTTCAATTGTGTC
  TGTGGTCCAGAAGAAATTATTTAATATGCATCTTTGAGAAT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_002758.3
• Summary: 'This gene encodes a member of the dual specificity protein kinase family, which functions as a mitogen-activated protein (MAP) kinase kinase. MAP kinases, also known as extracellular signal-regulated kinases (ERKs), act as an integration point for multiple biochemical signals. This protein phosphorylates and activates p38 MAP kinase in response to inflammatory cytokines or environmental stress. As an essential component of p38 MAP kinase mediated signal transduction pathway, this gene is involved in many cellular processes such as stress induced cell cycle arrest, transcription activation and apoptosis. [provided by RefSeq, Jul 2008]'
• Locus ID: 5608