Acinus (ACIN1) (NM_001164816) Human 3' UTR Clone

CAT#: SC207873

3`UTR clone of apoptotic chromatin condensation inducer 1 (ACIN1) transcript variant 4 for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "ACIN1"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol ACIN1
Synonyms ACINUS; ACN; fSAP152
ACCN NM_001164816
Insert Size 599
Sequence Data
>SC207873 3'UTR clone of NM_001164816
The sequence shown below is from the reference sequence of NM_001164816. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GAGTCGGAGCACACCTGTGCGGGACCGGGGTGGGCGCCGCTAGCTGGGAAAACACTAGAGCTGCAGGTAC
CAGCCACTCGGCCCCAGGGGGTTATGGCCACAGAGGGATAGGCACAGTCTCCACCACCCTGGAGCCAAGG
GTCTTTCACATCACCTATCCCTACATACATACCAAATGGAAAAGTGGCCATCCTTTTCCCCCCAAACACA
CCCCCTTAACCTATCTCTTGGGACTTAGCCCGACCCTCCCTCTCATTTCCCATTAAGTCTGAGAGGCAAG
AGCTAGGTTAGGCAAGGAGGTGGTTGGCCAGAGATGGGGAACAGCCAGGTGCCCCAGTCCTCTGATTTTT
CCTCCATCCTGCTTACCACCTCCCTGGGTACTTACAGCCTTCTCTTGGGAACAGCCGGGGCCAGGACTGG
GTCACCTATGAGCTGAATCAGCATCTCCTCCTGAGTCCCAGGGCCCCTGCAGTTCCCAGTCTCTTCTGTC
CTGCAGCCCTTGCCTCTTTCCCACAGGTTCCACTTTATATCCACCTTTTCCTTTTGTTCAATTTTTATTT
TTATTTTTTTTATTATTAAATGATGTGGTCTATGGAAAA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001164816.1
Summary Apoptosis is defined by several morphologic nuclear changes, including chromatin condensation and nuclear fragmentation. This gene encodes a nuclear protein that induces apoptotic chromatin condensation after activation by caspase-3, without inducing DNA fragmentation. This protein has also been shown to be a component of a splicing-dependent multiprotein exon junction complex (EJC) that is deposited at splice junctions on mRNAs, as a consequence of pre-mRNA splicing. It may thus be involved in mRNA metabolism associated with splicing. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Oct 2011]
Locus ID 22985

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.