HSD11B2 (NM_000196) Human 3' UTR Clone

CAT#: SC207992

3`UTR clone of hydroxysteroid (11-beta) dehydrogenase 2 (HSD11B2) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: HSD11B2
• Synonyms: AME; AME1; HSD2; HSD11K; SDR9C3
• ACCN: NM_000196
• Insert Size: 534 bp
• Sequence Data:
  Insert Sequence

  >SC207992 3'UTR clone of NM_000196
  The sequence shown below is from the reference sequence of NM_000196. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CAGCAGTGGCTCGGTGAGCCATGTGCACCTATGGCCCAGCCACTGCAGCACAGGAGGCTCCGTGAGCCCT
  TGGTTCCTCCCCGAAAACCCCCAGCATTACGATCCCCCAAGTGTCCTGGACCCTGGCCTAAAGAATCCCA
  CCCCCACTTCATGCCCACTGCCGATGCCCAATCCAGGCCCGGTGAGGCCAAGGTTTCCCAGTGAGCCTCT
  GCGCCTCTCCACTGTTTCATGAGCCCAAACACCCTCCTGGCACAACGCTCTACCCTGCAGCTTGGAGAAC
  TCCGCTGGATGGGGAGTCTCATGCAAGACTTCACTGCAGCCTTTCACAGGACTCTGCAGATAGTGCCTCT
  GCAAACTAAGGAGTGACTAGGTGGGTTGGGGACCCCCTCAGGATTGTTTCTCGGCACCAGTGCCTCAGTG
  CTGCAATTGAGGGCTAAATCCCAAGTGTCTCTTGACTGGCTCAAGAATTAGGGCCCCAACTACACACCCC
  CAAGCCACAGGGAAGCATGTACTGTACTTCCCAATTGCCACATT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_000196.3
• Summary: 'There are at least two isozymes of the corticosteroid 11-beta-dehydrogenase, a microsomal enzyme complex responsible for the interconversion of cortisol and cortisone. The type I isozyme has both 11-beta-dehydrogenase (cortisol to cortisone) and 11-oxoreductase (cortisone to cortisol) activities. The type II isozyme, encoded by this gene, has only 11-beta-dehydrogenase activity. In aldosterone-selective epithelial tissues such as the kidney, the type II isozyme catalyzes the glucocorticoid cortisol to the inactive metabolite cortisone, thus preventing illicit activation of the mineralocorticoid receptor. In tissues that do not express the mineralocorticoid receptor, such as the placenta and testis, it protects cells from the growth-inhibiting and/or pro-apoptotic effects of cortisol, particularly during embryonic development. Mutations in this gene cause the syndrome of apparent mineralocorticoid excess and hypertension. [provided by RefSeq, Feb 2010]'
• Locus ID: 3291