IKK gamma (IKBKG) (NM_001099857) Human 3' UTR Clone

CAT#: SC208002

3`UTR clone of inhibitor of kappa light polypeptide gene enhancer in B-cells kinase gamma (IKBKG) transcript variant 1 for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "IKBKG"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol IKBKG
Synonyms AMCBX1; EDAID1; FIP-3; FIP3; Fip3p; IKK-gamma; IKKAP1; IKKG; IMD33; IP; IP1; IP2; IPD2; NEMO; ZC2HC9
ACCN NM_001099857
Insert Size 598
Sequence Data
>SC208002 3'UTR clone of NM_001099857
The sequence shown below is from the reference sequence of NM_001099857. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

ATGGAGTGCATTGAGTAGGGCCGGCCAGTGCAAGGCCACTGCCTGCCGAGGACGTGCCCGGGACCGTGCA
GTCTGCGCTTTCCTCTCCCGCCTGCCTAGCCCAGGATGAAGGGCTGGGTGGCCACAACTGGGATGCCACC
TGGAGCCCCACCCAGGAGCTGGCCGCGGCACCTTACGCTTCAGCTGTTGATCCGCTGGTCCCCTCTTTTG
GGGTAGATGCGGCCCCGATCAGGCCTGACTCGCTGCTCTTTTTGTTCCCTTCTGTCTGCTCGAACCACTT
GCCTCGGGCTAATCCCTCCCTCTTCCTCCACCCGGCACTGGGGAAGTCAAGAATGGGGCCTGGGGCTCTC
AGGGAGAACTGCTTCCCCTGGCAGAGCTGGGTGGCAGCTCTTCCTCCCACCGGACACCGACCCGCCCGCT
GCTGTGCCCTGGGAGTGCTGCCCTCTTACCATGCACACGGGTGCTCTCCTTTTGGGCTGCATGCTATTCC
ATTTTGCAGCCAGACCGATGTGTATTTAACCAGTCACTATTGATGGACATTTGGGTTGTTTCCCATCTTT
TTGTTACCATAAATAATGGCATAGTAAAAATCCTTGTG

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001099857.1
Summary This gene encodes the regulatory subunit of the inhibitor of kappaB kinase (IKK) complex, which activates NF-kappaB resulting in activation of genes involved in inflammation, immunity, cell survival, and other pathways. Mutations in this gene result in incontinentia pigmenti, hypohidrotic ectodermal dysplasia, and several other types of immunodeficiencies. A pseudogene highly similar to this locus is located in an adjacent region of the X chromosome. [provided by RefSeq, Mar 2016]
Locus ID 8517

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.