FUK (NM_145059) Human 3' UTR Clone

CAT#: SC208064

3`UTR clone of fucokinase (FUK) for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol FUK
Synonyms 1110046B12Rik; CDGF2; FUK
ACCN NM_145059
Insert Size 596
Sequence Data
>SC208064 3'UTR clone of NM_145059
The sequence shown below is from the reference sequence of NM_145059. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CTCAACCTGTTGCCCTTTCCCATGAAGCTGGCTTCTCTCTGCAACAGGAGAAAACCTGGAGCTACAGTGT
CCCCCACCTTCCTTGCCCCATGGGAACCTCCACCTCCTACTCCCCACCCACCTCTGCGAATCTGCTCCCA
AAGGAAGCTGACCAGAGCAAGATCTGGGCAAGCAGAGAGTGCCTGGGACAGGACTGTGACCTGGTGGACA
GGGGCCTAGATGTAGCCTCTGTTCCTCCTGGACATAGGAAGGTCCCAAGCTTAGTATCCCACGTGGCCTT
TACAAATCCTATGGCTGGCCTTCTCATTCCACAAGGGCCCTGGAAAGGGTTGACAGCCAGCCTTGGCATA
TGGCTGGGAGTCCCTTAGCAAGGCCAACCCTGAAGAGGCCCTTTGAGGCATTCCCTATGGCTTAGAGTTG
TAGACTTACACTCAACCCTCATGTGAGCGTGGGAGTGAGGGTGGCGGTCCCTTGCCAAGTTGGTAGCAGT
GACCCAGTGATTCACTGCCATCCCAGGCCTTAACTAGCAAAACTACGGAGCGTGCCAAGTGACCTGGTGC
CTGTGGGAAGTGGGTTCTCAGGACTGGCATTCTTGG

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_145059.2
Summary The protein encoded by this gene belongs to the GHMP (galacto-, homoserine, mevalonate and phosphomevalonate) kinase family and catalyzes the phosphorylation of L-fucose to form beta-L-fucose 1-phosphate. This enzyme catalyzes the first step in the utilization of free L-fucose in glycoprotein and glycolipid synthesis. L-fucose may be important in mediating a number of cell-cell interactions such as blood group antigen recognition, inflammation, and metastatis. While several transcript variants may exist for this gene, the full-length nature of only one has been described to date. [provided by RefSeq, Jul 2008]
Locus ID 197258

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.