ARAP1 (NM_015242) Human 3' UTR Clone

CAT#: SC208113

3`UTR clone of ArfGAP with RhoGAP domain ankyrin repeat and PH domain 1 (ARAP1) transcript variant 1 for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "ARAP1"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol ARAP1
Synonyms CENTD2
ACCN NM_015242
Insert Size 587
Sequence Data
>SC208113 3'UTR clone of NM_015242
The sequence shown below is from the reference sequence of NM_015242. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

TCTCTTCTGCGCAACGTCTGAGCACAGGAGCCCATCCTTGGCTCTAGGATTCCGCCGCTGGAAGCCTTCT
GTTCAGACACCCCTTATGCTCCAAGGCCTGATGTGAGCCAGCGGGGGGTGCATGGGAAACTGCACCCCAC
AACCCACATCCTCCATCCTGACTGCAGCATGGGGTTCCCCGGCAGGGGTGGGAGGCAGCAGGGGTCAGCC
TGGGCAGGAACCTCTCCCAACTCTGTCCAGGTGTTCAGACCTCTTGGCCCAACCTGCTCACCCCACCGGG
TTCACTGTCCTTGTGGGGCTGGAGAGATGGGCATAAGTCAGGAACTTGGGAGGACCACCACCCTTTCAGA
GGCGTGAGGCCCTGGGGCCCTGCCGGAAGGGAGCCCCCTGCTCCTCCCAACAAACTCCAGAACAGCAGAA
AGCGGGTGCTGTAGAGGAGCACTCAGCTCACGGGGAGGGAGCTCTTGGCTGAGCTTCTACAGGGCTGAGA
GCTGCGCTTTGGGGACTTCAGCCTTCCTTCCAGTCTGGGCTGAGTGGGGGGTCCAGACTACCTGATGCCC
CTTCCCCAATTTGGGGACTTTTTGATA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_015242.4
Summary The protein encoded by this gene contains SAM, ARF-GAP, RHO-GAP, ankyrin repeat, RAS-associating, and pleckstrin homology (PH) domains. In vitro, this protein displays RHO-GAP and phosphatidylinositol (3,4,5) trisphosphate (PIP3)-dependent ARF-GAP activity. The encoded protein associates with the Golgi, and the ARF-GAP activity mediates changes in the Golgi and the formation of filopodia. It is thought to regulate the cell-specific trafficking of a receptor protein involved in apoptosis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2008]
Locus ID 116985

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.