CD97 (ADGRE5) (NM_001784) Human 3' UTR Clone

CAT#: SC208160

3`UTR clone of CD97 molecule (CD97) transcript variant 2 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "ADGRE5"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol ADGRE5
Synonyms CD97; TM7LN1
ACCN NM_001784
Insert Size 601 bp
Sequence Data
>SC208160 3'UTR clone of NM_001784
The sequence shown below is from the reference sequence of NM_001784. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CATCAGAGTCCGGCATATGAAGGCGCATGGTTCTGGACGGCCCAGCAGCTCCTGTGGCCACAGCAGCTTT
GTACACGAAGACCATCCATCCTCCCTTCGTCCACCACTCTACTCCCTCCACCCTCCCTCCCTGATCCCGT
GTGCCACCAGGAGGGAGTGGCAGCTATAGTCTGGCACCAAAGTCCAGGACACCCAGTGGGGTGGAGTCGG
AGCCACTGGTCCTGCTGCTGGCTGCCTCTCTGCTCCACCTTGTGACCCAGGGTGGGGACAGGGGCTGGCC
CAGGGCTGCAATGCAGCATGTTGCCCTGGCACCTGTGGCCAGTACTCGGGACAGACTAAGGGCGCTTGTC
CCATCCTGGACTTTTCCTCTCATGTCTTTGCTGCAGAACTGAAGAGACTAGGCGCTGGGGCTCAGCTTCC
CTCTTAAGCTAAGACTGATGTCAGAGGCCCCATGGCGAGGCCCCTTGGGGCCACTGCCTGAGGCTCACGG
TACAGAGGCCTGCCCTGCCTGGCCGGGCAGGAGGTTCTCACTGTTGTGAAGGTTGTAGACGTTGTGTAAT
GTGTTTTTATCTGTTAAAATTTTTCAGTGTTGACACTTAAA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_001784.3
Summary 'This gene encodes a member of the EGF-TM7 subfamily of adhesion G protein-coupled receptors, which mediate cell-cell interactions. These proteins are cleaved by self-catalytic proteolysis into a large extracellular subunit and seven-span transmembrane subunit, which associate at the cell surface as a receptor complex. The encoded protein may play a role in cell adhesion as well as leukocyte recruitment, activation and migration, and contains multiple extracellular EGF-like repeats which mediate binding to chondroitin sulfate and the cell surface complement regulatory protein CD55. Expression of this gene may play a role in the progression of several types of cancer. Alternatively spliced transcript variants encoding multiple isoforms with 3 to 5 EGF-like repeats have been observed for this gene. This gene is found in a cluster with other EGF-TM7 genes on the short arm of chromosome 19. [provided by RefSeq, Jun 2011]'
Locus ID 976

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.