CD97 (ADGRE5) (NM_078481) Human 3' UTR Clone

CAT#: SC208161

3`UTR clone of CD97 molecule (CD97) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: ADGRE5
• Synonyms: CD97; TM7LN1
• ACCN: NM_078481
• Insert Size: 601 bp
• Sequence Data:
  Insert Sequence

  >SC208161 3'UTR clone of NM_078481
  The sequence shown below is from the reference sequence of NM_078481. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CATCAGAGTCCGGCATATGAAGGCGCATGGTTCTGGACGGCCCAGCAGCTCCTGTGGCCACAGCAGCTTT
  GTACACGAAGACCATCCATCCTCCCTTCGTCCACCACTCTACTCCCTCCACCCTCCCTCCCTGATCCCGT
  GTGCCACCAGGAGGGAGTGGCAGCTATAGTCTGGCACCAAAGTCCAGGACACCCAGTGGGGTGGAGTCGG
  AGCCACTGGTCCTGCTGCTGGCTGCCTCTCTGCTCCACCTTGTGACCCAGGGTGGGGACAGGGGCTGGCC
  CAGGGCTGCAATGCAGCATGTTGCCCTGGCACCTGTGGCCAGTACTCGGGACAGACTAAGGGCGCTTGTC
  CCATCCTGGACTTTTCCTCTCATGTCTTTGCTGCAGAACTGAAGAGACTAGGCGCTGGGGCTCAGCTTCC
  CTCTTAAGCTAAGACTGATGTCAGAGGCCCCATGGCGAGGCCCCTTGGGGCCACTGCCTGAGGCTCACGG
  TACAGAGGCCTGCCCTGCCTGGCCGGGCAGGAGGTTCTCACTGTTGTGAAGGTTGTAGACGTTGTGTAAT
  GTGTTTTTATCTGTTAAAATTTTTCAGTGTTGACACTTAAA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_078481.2
• Summary: 'This gene encodes a member of the EGF-TM7 subfamily of adhesion G protein-coupled receptors, which mediate cell-cell interactions. These proteins are cleaved by self-catalytic proteolysis into a large extracellular subunit and seven-span transmembrane subunit, which associate at the cell surface as a receptor complex. The encoded protein may play a role in cell adhesion as well as leukocyte recruitment, activation and migration, and contains multiple extracellular EGF-like repeats which mediate binding to chondroitin sulfate and the cell surface complement regulatory protein CD55. Expression of this gene may play a role in the progression of several types of cancer. Alternatively spliced transcript variants encoding multiple isoforms with 3 to 5 EGF-like repeats have been observed for this gene. This gene is found in a cluster with other EGF-TM7 genes on the short arm of chromosome 19. [provided by RefSeq, Jun 2011]'
• Locus ID: 976