Neurokinin A Receptor (TACR2) (NM_001057) Human 3' UTR Clone

CAT#: SC208231

3`UTR clone of tachykinin receptor 2 (TACR2) for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "TACR2"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol TACR2
Synonyms NK2R; NKNAR; SKR; TAC2R
ACCN NM_001057
Insert Size 644 bp
Sequence Data
>SC208231 3'UTR clone of NM_001057
The sequence shown below is from the reference sequence of NM_001057. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

TGGGTATGGTTTGCTTGCCCCCACCAAAACTCATGTTGAAATTTGATCCCAATGTGGCAGTGTTGGGAGG
TAGGGGTTAGTGGGAGGTGTTTGGGTATTGGGGATGGATCCCTTATGAATAGATTAATGCCTTCCAGTTG
AAGTGAATCATCACTCTTGTGGGAATGGACTAGTTCCCAAAATAACAAGTTGTTAGAAAGAGTGTGGTGT
CCTCAGTTTCCCTGTCTTGCTTCCTCTCTCACCATGTGATCTCTTTGCACACAACACTTCCCTTCCACTT
TCCACCATGACAAGAAGCAGCCTGAGGCCTTCACCAGATGCAGCTGCCCAATCTTGGATATTCCAGCCAC
CAGAATCATGAGCCAAATAAACCTCTTTTCTTTATAAATTACCTAGTCTCAGGTATTCCATGAAAGCAAC
ACAAATGGACTGAGATAGGTGCCTATTGAACCCTGAAGCCTTGTGCCTGGCTGCAGAATGAGGTGTAGCA
CCCTTTGAGAAGTAGCCAATCGAGAAGACCACATCTGAAAGTTCAGCTCATGCCCCATCCTTCAGTATAC
CAATACAAAGACAACATGGGGCCAGAACTCCAGAAAGGATGCTGACTTTAAGAGGACTCAGCCACCCATC
TCAGAGAGCACTTC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_001057.2
Summary 'This gene belongs to a family of genes that function as receptors for tachykinins. Receptor affinities are specified by variations in the 5'-end of the sequence. The receptors belonging to this family are characterized by interactions with G proteins and 7 hydrophobic transmembrane regions. This gene encodes the receptor for the tachykinin neuropeptide substance K, also referred to as neurokinin A. [provided by RefSeq, Jul 2008]'
Locus ID 6865

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.