Cyclophilin 40 (PPID) (NM_005038) Human 3' UTR Clone

CAT#: SC208251

3`UTR clone of peptidylprolyl isomerase D (PPID) for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "PPID"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol PPID
Synonyms CYP-40; CYPD
ACCN NM_005038
Insert Size 638 bp
Sequence Data
>SC208251 3'UTR clone of NM_005038
The sequence shown below is from the reference sequence of NM_005038. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

AAAGAGAAGGCAGTATATGCAAAAATGTTTGCTTAGAAAGGATTCAGTTTTGCTTATTGTGTGTTGATTG
TATAAATGCAATAAGAAAATGTAAAGGTTTTTGTCTATGAATATGATCCCTAATGTGTTTCTTTTGACAC
CTTAGTTCCTTACTGTTTACAGTTTAGGAGTACTGATAGGGGTTCATGCTTAATAAACATGTCACAATAC
AGTAAGTAAAGTGGTTTTGTTTGTTTCTTTGAGATGGAGTCTTGCTCTGTCACCCAGGCTGGAGTGCGGT
GGCGCAATCTCGGCTCACTGCATCCTCTGCCTCCCGGGTTCAAGCAATTCTCCTGCCTCAGCTTCCCAAG
TAGCTGGGATTACAGGCACGTGCCACCACGCCCAGCTAATTTTTGTATTTTTAGTAGAGATGGGGTTTCA
CCATATTGGTCACGTCACGTTGGTCTTGAACTCCTGACCTTGTGATCCACCCCGCCTTGGCCTCCCAAAG
TGCTGGGATTACAGGTGTGAGCCACCGTGCCCGGCCAAGTAAAATGTTTTTTAAAATGGTTATGTGCATT
ATTCATAAAAAATAATGGTGTCCAGTCTTTTTAAACTTGTAAAGACACATCTTATTGAATAAAGAGATGA
GAGCTTAA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_005038.2
Summary 'The protein encoded by this gene is a member of the peptidyl-prolyl cis-trans isomerase (PPIase) family. PPIases catalyze the cis-trans isomerization of proline imidic peptide bonds in oligopeptides and accelerate the folding of proteins. This protein has been shown to possess PPIase activity and, similar to other family members, can bind to the immunosuppressant cyclosporin A. [provided by RefSeq, Jul 2008]'
Locus ID 5481

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.